Psammomoya choretroides

(F.Muell.) Diels & Loes. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Psammomoya

At a glance

Occurrence records343

Data sources7

Biological traits21

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Psammomoya choretroides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF343 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Psammomoya choretroides is a small shrub in the Celastraceae family, endemic to the south west of Western Australia. It was first described by Ferdinand von Mueller in 1889 as Logania choretroides, but was transferred to the genus, Psammomoya, in 1904 by Ludwig Diels and Ludwig Eduard Theodor Loesener.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Fruit length8.5 mm

Fruit width7.5 mm

Plant height0.425 m

Plant height max0.45 m

Seed length4.1 mm

Seed width1.9 mm

Life cycle & reproduction4

Flowering timennnnnnnyyynn

Life formsubshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psammomoya choretroides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSEU328712.1 ↗720 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAACGCTGAACGACCCGTGAATTGGTGATAACTAACTAGGGGGACGG …

Psammomoya choretroides 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type343 records

Wild obs. + sensor95

Museum / vouchered248

Origin

Native8

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 68≤1 km 6≤10 km 5>10 km 1

80 georeferenced · 15 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 35≤1 km 21≤10 km 129>10 km 12

197 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	143
Canberra, AU	27
Museo Entomologico de Leonlocation not on record	23
Adelaide, AU	22
Mount Annan, AU	8
Brisbane, AU	5
Kew, GB	4
BGPAlocation not on record	4
Claremont, US	3
Hobart, AU	2
University of Stellenboschlocation not on record	2
Palmerston, AU	2
EL PASO, US	1

13 institutions · 246 of 248 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Psammomoya choretroides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)