Psaltoda moerens

(Germar, 1834) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadidae/Psaltoda

At a glance

Occurrence records2 924

Data sources5

Biological traits0

DNA specimens20

eDNA detections25

Sources5 archives

Databases and archives Psaltoda moerens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 924 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 924 records

Environmental DNA2 datasets · 1 countries25 detections

DNA & barcodingBOLD20 specimens

01Narrative

Psaltoda moerens, commonly known as the redeye, is an Australian species of cicada. It is distributed through the south-east of Australia, from southern Queensland to South Australia, as well as Tasmania.Wildlife of Sydney - Fact File - Red Eye Populations can vary greatly between years; one year they may be present in large numbers and the next they may be entirely absent. They feed primarily on eucalyptus but also on Angophora trees. As they feed on tree sap they expel small droplets of clear waste fluid. When numbers are high, this can form a constant stream.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psaltoda moerens has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes4

eDNA detections25

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

88Tmostly conserved

235Cmostly conserved

268Gmostly conserved

394Cmostly conserved

409Gmostly conserved

547Cmostly conserved

614Gmostly conserved

GACAATATATTTTATTTTTGGTATTTGATCAGGAATAGTGGGAACTGCTATAAGAGTTATAATTCGAATCGAGTTAGGTACTCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes5

BIN1

Most divergent pair0.46%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psaltoda magnificasame genus9.9%Psaltoda plagasame genus12.3%Psaltoda claripennissame genus13.4%Psaltoda harrisiisame genus13.5%Diceroprocta semicinctasame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 924 records

Wild obs. + sensor2 496

Museum / vouchered428

Origin

Native11

Range

Area of Occupancy AOO5 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 216≤1 km 286≤10 km 145>10 km 139

1 786 georeferenced · 710 without coordinates

Open the mapobservation + sensor2 496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 34≤1 km 22≤10 km 183>10 km 31

270 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence428

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	138
Sydney, AU	79
Museums Victorialocation not on record	67
Tasmanian Museum & Art Gallerylocation not on record	65
DPIlocation not on record	45
Natick, US	7
QVMAGlocation not on record	5
Western Australian Museumlocation not on record	3
Australian National Insect Collectionlocation not on record	1
Auckland, NZ	1

10 institutions · 411 of 428 vouchered records shown · 17 without an institution code

09Environmental DNA25 detections

Where the DNA of Psaltoda moerens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.80 5.60–7.10

Conductivity31.0 µS/cm 22.0–82.0

Organic carbon0.89 % 0.11–2.51

Nitrate-N2.50 mg/kg 2.00–7.00

Phosphorus15.0 mg/kg 3.00–40.0

Clay11.7 % 5.00–42.6

Sand78.0 % 38.1–91.0

Depth0.2 m 0–0.2

SoilTenosol

9 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 13.4–22.4

Seasonal swing summer↔winter13.1 °C

Max temp (day)21.9 °C 19.4–24.1

Min temp (night)10.4 °C 7.90–20.9

Precipitation62.2 mm/mo 56.7–110

Air humidity57.4 % 55.7–61.6

Moisture balance-75.0 mm/mo

Vapour deficit827 Pa 663–1,033

Wind speed4.00 m/s

Cloud cover26.4 % 25.2–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psaltoda moerens

At a glance

Sources5 archives

At a glance

Record type2 924 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 924 records