Psallus haematodes

(Gmelin, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Psallus

At a glance

Occurrence records1 575

Data sources7

Biological traits0

DNA specimens25

eDNA detections93

Sources7 archives

Databases and archives Psallus haematodes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 575 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 575 records

Environmental DNA3 datasets · 6 countries93 detections

DNA & barcodingBOLD25 specimens

01Narrative

Psallus haematodes is a true bug. The species is found in the Palearctic.It occurs almost everywhere in Europe, but only occurs in the north of the Mediterranean. East the range extends to Siberia and to the Caspian region. It is introduced in North America.Berend Aukema and Christian Rieger (Editors) Catalogue of the Heteroptera of the Palaearctic Region (5-Volumes and supplement) Amsterdam: The Netherlands Entomological Society(Nederlandse Entomologische Vereniging) 1995-2006 . It is found in open, sunny, but also shady places on wetland edges, rivers and in bogs, and also in dry habitats. Psallus haematodes feeds on willow (Salix), Salix caprea, Salix aurita Salix cinerea, Salix repens and Salix viminalis. Adults are found in late summer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psallus haematodes has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes1

eDNA detections93

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

4Tmostly conserved

262Amostly conserved

292Amostly conserved

340Tmostly conserved

427Cmostly conserved

631Avariable

640Cmostly conserved

641Tmostly conserved

652Cmostly conserved

CACTCTATATTTTTTATTTGGAATATGGGCAGGAATATTAGGCACATCCCTAAGATGAATTATCCGAATTGAATTGGGAATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes7

BINs2

Most divergent pair12.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psallus fallenisame genus5.2%Psallus salicissame genus5.5%Psallus flavellussame genus7.3%Psallus lepidussame genus7.6%Coquillettia albaclavasame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 575 records

Wild obs. + sensor984

Museum / vouchered568

Other23

Range

Area of Occupancy AOO3 816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 410≤1 km 304≤10 km 229

943 georeferenced · 41 without coordinates

Open the mapobservation + sensor984

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 387≤1 km 72≤10 km 69>10 km 2

530 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence568

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	76
Natural History Museum, Aarhus Denmarklocation not on record	41
Philadelphia, US	20
NCMGlocation not on record	20
SLU Artdatabankenlocation not on record	17
CBDClocation not on record	16
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Norwegian Institute of Bioeconomy Researchlocation not on record	4
ZMAAlocation not on record	4
Tromsø, NO	3
BioFokuslocation not on record	3
Forssa, FI	3
ZSMlocation not on record	2
NTNU University Museumlocation not on record	2
Kuopio, FI	1
Metsähallituslocation not on record	1
South Kensington, GB	1
Natural History Museum, Londonlocation not on record	1

18 institutions · 219 of 568 vouchered records shown · 349 without an institution code

09Environmental DNA93 detections

Where the DNA of Psallus haematodes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys3

Countries6

Verifiable raw sequence linked71

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.0–17.4

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.9 °C 14.9–21.4

Min temp (night)11.1 °C 6.40–13.4

Precipitation93.8 mm/mo 67.9–114

Air humidity61.0 % 58.7–64.0

Moisture balance7.30 mm/mo -55.0–39.5

Vapour deficit630 Pa 526–803

Wind speed2.80 m/s 2.00–3.50

Cloud cover50.8 % 40.1–57.5

CHELSA 1981–2010, ~9 km grid, at location & month of 92 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Psallus haematodes

At a glance

Sources7 archives

At a glance

Record type1 575 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 575 records