Psalidostetha banksiae

(Lewin, 1805) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Psalidostetha

At a glance

Occurrence records338

Data sources7

Biological traits0

DNA specimens18

eDNA detections17

Sources7 archives

Databases and archives Psalidostetha banksiae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility338 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF338 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD18 specimens

01Narrative

Psalidostetha banksiae, also known as the banksia moth is a moth of the family Notodontidae. It is found throughout Australia. Its wingspan is about 6 cm. The larvae feed on Banksia, Hakea, Dryandra and Grevillea leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Psalidostetha banksiae has left across the world's sequence archives.

At a glance

DNA specimens18

BINs5

Marker genes2

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 51 variable positions, in barcode order

7Avariable

10Tmostly conserved

16Tmostly conserved

22Amostly conserved

25Cvariable

37Avariable

58Amostly conserved

67Avariable

68Gmostly conserved

76Amostly conserved

79Avariable

139Cvariable

160Gvariable

163Tmostly conserved

187Tvariable

205Tmostly conserved

217Gvariable

232Tmostly conserved

259Tvariable

266Tmostly conserved

287Tmostly conserved

304Cvariable

307Gvariable

312Gmostly conserved

316Avariable

352Avariable

355Tvariable

358Tmostly conserved

361Tmostly conserved

364Cmostly conserved

385Tmostly conserved

400Cmostly conserved

406Tvariable

412Avariable

421Amostly conserved

428Tmostly conserved

463Cmostly conserved

466Amostly conserved

487Tmostly conserved

526Tmostly conserved

550Gvariable

562Gvariable

577Gmostly conserved

595Tvariable

596Cvariable

604Cmostly conserved

619Amostly conserved

622Avariable

628Avariable

646Cmostly conserved

653Tvariable

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes7

BINs5

Most divergent pair4.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ethmia lineatonotellasame order8.8%Ethmia lineatanotellasame order8.8%Trisula variegatasame order9.0%Schizura badiasame family9.0%Lichnoptera polluxsame order9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type338 records

Wild obs. + sensor210

Museum / vouchered128

Origin

Native1

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 64≤1 km 57≤10 km 28>10 km 14

163 georeferenced · 47 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 11≤1 km 3≤10 km 36>10 km 11

61 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	57
Museums Victorialocation not on record	54
Tasmanian Museum & Art Gallerylocation not on record	11
New Haven, US	1
Natick, US	1

5 institutions · 124 of 128 vouchered records shown · 4 without an institution code

09Environmental DNA17 detections

Where the DNA of Psalidostetha banksiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 11.3–26.3

Seasonal swing summer↔winter8.60 °C

Max temp (day)23.8 °C 15.2–30.5

Min temp (night)16.5 °C 7.10–22.9

Precipitation60.7 mm/mo 12.0–125

Air humidity58.7 % 52.1–61.6

Moisture balance-45.1 mm/mo

Vapour deficit1,033 Pa 555–1,541

Wind speed4.20 m/s

Cloud cover25.8 % 11.9–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)