Prunus maritima

Marshall · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Prunus

At a glance

Occurrence records2 819

Data sources10

Biological traits93

DNA specimens5

eDNA detections7

Sources10 archives

Databases and archives Prunus maritima's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 819 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources93 traits

Occurrence & distributionGBIF2 819 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Prunus maritima est une espèce de plantes à fleurs de la famille des Rosaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height3.7 m

Seed mass203 mg

⚠ sources differ — TRY: 203 mg · GIFT: 181 mg

Life cycle & reproduction23

Bloom periodLate Spring

Coppice potentialYes

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formshrub

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment25

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterModerate

Foliage textureCoarse

Fruit colourblue

Growth formshrub

Growth form USDAMultiple Stem

Hedge toleranceLow

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza type0.0000000244

Root depth min20 in

Shape and orientationRounded

Small grainNo

Woodinesswoody

Physiology & chemistry20

Anaerobic toleranceLow

C:N ratioHigh

Caco3 toleranceMedium

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min150 days

Moisture useMedium

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max60 in

Precipitation min36 in

Protein potentialLow

Salinity toleranceLow

Shade toleranceHigh

Soil pH max7.7 pH

Soil pH min5.8 pH

Temperature min-20.5 °F

Uses & economy15

Berry nut seed productYes

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalMedium

Palatable graze animalLow

Palatable humanYes

Post productNo

Pulpwood productNo

Seeds per pound2 500 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousYes

Fruit seed persistenceNo

Height at 20yr3.66 m

Planting density max2 200 per acre

Planting density min700 per acre

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prunus maritima has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ034156.1 ↗574 bp

ACGT

CCTGCCTAGCAGAACGACCCGAGAACTAGTTTCAAAGCGGGGGACGAGGGGCCGTCTCGGCGTGCTCCTCGTCCCTTTATCTCGGGGGGG …

Prunus maritima voucher Wen7311 (US) 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA and genes, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Prunus maritima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Anderson, G. J. 1980. The status of the very rare Prunus gravesii Small. Rhodora 82(829): 113–129.

CCDB · book-atlas-flowering-plants — Sax 193la

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 819 records

Wild obs. + sensor2 374

Museum / vouchered406

Cultivated / captive5

Other34

Origin

Native15

Range

Area of Occupancy AOO3 636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 715≤1 km 205≤10 km 108>10 km 75

2 103 georeferenced · 271 without coordinates

Open the mapobservation + sensor2 374

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 51≤10 km 248>10 km 30

331 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence406

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	119
Bronx, US	56
University of New Hampshirelocation not on record	34
New Haven, US	33
Chongqing Museumlocation not on record	25
Burlington, US	16
Staten Island, US	15
Wuzhou, CN	5
University of Stellenboschlocation not on record	4
Kingston, US	4
Philadelphia, US	4
Bloomington, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Moscow State Universitylocation not on record	2
Keene State Universitylocation not on record	2
Millersville, US	2
Dover, US	2
Bangkok, TH	2
New Brunswick, US	2
Brookings, US	2
Denver, US	1
Washington, US	1
Chapel Hill, US	1
Saint Louis, US	1
Durham, US	1
Davenport, US	1
Santa Barbara, US	1
South Kensington, GB	1
St. Paul, US	1
Longwood Universitylocation not on record	1

30 institutions · 346 of 406 vouchered records shown · 60 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Prunus maritima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prunus maritima

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction23

Diet & foraging1

Habitat & environment25

Physiology & chemistry20

Uses & economy15

Other traits7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 819 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 819 records