Prunus domestica
speciesAt a glance
Occurrence records76 798
Data sources12
Biological traits64
DNA specimens38
eDNA detections37
Sources12 archives
Databases and archives Prunus domestica's data was compiled from.
GBIFGlobal Biodiversity Information Facility76 798 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources64 traits
Chemical compositionFooDB · NPASS5 706 compounds
Occurrence & distributionGBIF76 798 records
Environmental DNA1 datasets · 5 countries37 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT743 Mbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length22.5 mm
⚠ sources differ — AusTraits: 22.5 mm · GIFT: 17.5 mm
Fruit length max25 mm
Fruit length min10 mm
Fruit width22.5 mm
⚠ sources differ — AusTraits: 22.5 mm · GIFT: 17.5 mm
Fruit width max25 mm
Fruit width min10 mm
Leaf length70 mm
Leaf length max100 mm
Leaf length min40 mm
Leaf size3 162 mm²
Leaf width32.5 mm
⚠ sources differ — AusTraits: 32.5 mm · GIFT: 37.5 mm
Leaf width max50 mm
Leaf width min25 mm
Petiole length1.5 cm
Plant height6.83 m
⚠ sources differ — GIFT: 6.83 m · AusTraits: 10 m · LEDA: 3.5 m · TRY: 7.8 m
Plant height generative3.5 m
Plant height max15 m
Plant height min3 m
Seed mass739 mg
⚠ sources differ — TRY: 739 mg · GIFT: 546 mg
Seed mass max1 015 mg
Seed mass min227 mg
Seed volume590 mm³
Seed volume max590 mm³
Seed volume min590 mm³
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower length max15 mm
Flower length min10 mm
Flowering endApr
Flowering startApr
Life formtree
Life spanperennial
Lifespan years15 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 900 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
Growth formtree
⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: tree
Habitat GIFTwidely distributed
Leaf compoundnesssimple
Leaf shapeelliptical obovate
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry8
Leaf C:N ratio29.2 g/g
Leaf c499 mg/g
Leaf dry-matter content (LDMC)361 mg/g
Leaf n17.11 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)8.31 mm²/mg
Wood density629 mg/cm³
Other traits1
Diaspore typefruit
03Chemical composition5 706 compounds
Compounds documented for Prunus domestica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Aminoacids200
Pyridine alkaloids67
Cinnamic acids and derivatives59
Glycerophospholipids57
pteridine alkaloids45
Documented compounds5 706 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 39,500 mg/100g | FooDB | |
| Sucrose | 39,500 mg/100 g | FooDB | |
| Elaidic acid | 28,044 mg/100g | FooDB | |
| D-Mannose | 25,460 mg/100g | FooDB |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prunus domestica has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes9
GenBank sequences10
eDNA detections37
Countries6
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC …
Prunus domestica subsp. insititia voucher PLT.0477 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK4★rbcL1★rbcLa★ITS5★ITS1★ITS2rpoBtrnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Prunus domestica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size743 280 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Prunus domestica0.74 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy6× hexaploid · measured
Chromosome records16–482n range48median48mode49records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4841×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Haspelová A., 1960: Chromozómové analýzy sliviek používaných ako podpníky pre staré marhule na Slovensku a na južnej Morave. - Biológia (Bratislava) 15/9: 690-693.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2714
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
CCDB · book-ipcn73-74 — SALESSES, G. 1970. Etudes cytologiques chez les Prunus. I. Especes la section Euprunus. Ann. Amelior. Pl. 20: 469-48-3-.----
CCDB · book-indian_vol1 — Crane, M.B. 1927 ; Darlington, C.D. 1927a, 1930a ; Kobel, F. 1927b, 1928 ; Crane, M.B. & Lawrence, W.J.C. 1929, 19J1a, b; Lawrence, W.J.C. 1930; Sax, K. 193la ; Rybm, V.A. (Fedorov) ; Mather, K. 1937 ; Flory, W .S. 1940c; Dermen, H. 1941; Salesses, G. 1970
CCDB · book-atlas-flowering-plants — Darlington 1928
CCDB · book-atlas-flowering-plants — Darlington 1930
CCDB · kew — Arumuganathan K, Earle ED. 1991. Nuclear DNA content of some important plant species. Plant Molecular Biology Reporter 9: 208-218.
CCDB · CromoCat 2015 — Chen, R.-y. (1993). Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas of Chinese Principal Economic Plants 1.
CCDB · CromoCat 2015 — Crane, M. B. & Lawrence, W. J. C.. (1930). Sterility and incompatibility in diploid and polyploid fruits. J. Genet. 24: 97-107.
CCDB · CromoCat 2015 — Crane, M. B. (1927). Studies in relation to sterility in plums, cherries, apples and rapsberries Mem. Hortic. Soc. New York 3: 119-134.
CCDB · CromoCat 2015 — Crane, M. B. (1929). Polyploidy and sterility in cultivated fruits. John Innes Hort. Inst. Conf. Polypl 1929: 38-41.
CCDB · CromoCat 2015 — Darlington, C. D. (1927). The behaviour of polyploid Nature 119: 390-391.
CCDB · CromoCat 2015 — Darlington, C. D. (1928). Studies in Prunus. I-II. J. Genet. 19: 213-256.
CCDB · CromoCat 2015 — Darlington, C. D. (1930). Studies in Prunus. III. J. Genet. 22: 65-93.
CCDB · CromoCat 2015 — Gabrielan, E. & Zohary, D. (2004). Wild relatives of food crops native to Armenian and Nakhichevan Fl. Medit. 14: 5-80
CCDB · CromoCat 2015 — Haspelová, A. (1960). Chromozómové analýzy sliviek používaných ako podpníky pre staré marhule na Slovensku a na južnej Morave. iológia (Bratislava) B 15/9: 690-693.
CCDB · CromoCat 2015 — Kobel, F. (1927). Zytologische untersuchungen an Prunoideen und Pomoideen. Arch. Julius-Klaus-Stiftung 3:
CCDB · CromoCat 2015 — Kobel, F. (1928). Zytologische untersuchungen an kern und steinobstarten. Z. Vererb. Suppl. 2: 927-930.
CCDB · CromoCat 2015 — Lawrence, W. J. C. (1930). Incompatibility in polyploids. Genetica 12(1-2): 269-296.
CCDB · CromoCat 2015 — Lin, S.-h., Pu, F.-s., Zhang, J.-y., Gao, X.-y. & Li, X.-j. (1991). Observation on the chromosome number of Prunus. China Fruits? (2): 8-10.
CCDB · CromoCat 2015 — Mather, K. (1937). Notes on the cytology of some Prunus species. Genetica 19: 143-152.
CCDB · CromoCat 2015 — Moffett, A. A. (1931b). The chromosome constitution of the Pomoideae. Proc. Roy. Soc. London, Ser. B 108(758): 423-446.
CCDB · CromoCat 2015 — Sachoff, T. (1931). Untersuchungen über die fruchtbarkeit der süsskirschen, sauerkirschen, zwetschen und pflaumensorten. Gartenbauwiss. 5: 574-579.
CCDB · CromoCat 2015 — Sax, K. (1931). The origin and relationships of Pomoideae. J. Arnold Arbor. 12: 3-22.
CCDB · CromoCat 2015 — Weimarck, H. (1942). Bidrag till Skanes Flora. XV. En spontan hybrid mellan slan och terson. Bot. Not. 95: 218-226.
CCDB · CromoCat 2015 — Weimarck, H. (1943). Om pollenkorn och klyvöppningar hos Prunus insititia, P. spinosa och hybriden dem emellan. Bot. Not. 96: 389-399.
2n 166×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & V. K. Singhal. 1981. In Chromosome number reports LXXI. Taxon 30: 513–514.
CCDB · book-indian_vol1 — Okabe, S. 1927
CCDB · CromoCat 2015 — Blanca, G & Díaz de la Guardia, C. (1998). Prunus L. In S.Castroviejo et al (eds), Flora Iberica 6: 444-446 RJBM-CSIC Madrid
CCDB · CromoCat 2015 — Lin, S.-h., Pu, F.-s., Zhang, J.-y., Gao, X.-y. & Li, X.-j. (1991). Observation on the chromosome number of Prunus. China Fruits? (2): 8-10.
CCDB · CromoCat 2015 — Singhal, V. K., B. S. Gill & M. S. Sidhu. (1990). Cytology of woody members of Rosaceae. Proc. Ind. Acad. Sci. B 100: 17-21.
CCDB · CromoCat 2015 — Gill, B. S., Bir, S. S. & Singhal, V. K. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 513-514.
2n 322×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Blanca, G & Díaz de la Guardia, C. (1998). Prunus L. In S.Castroviejo et al (eds), Flora Iberica 6: 444-446 RJBM-CSIC Madrid
CCDB · CromoCat 2015 — Singhal, V. K., B. S. Gill & M. S. Sidhu. (1990). Cytology of woody members of Rosaceae. Proc. Ind. Acad. Sci. B 100: 17-21.
n 82×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Singhal, V. K., B. S. Gill & M. S. Sidhu. 1990. Cytology of woody members of Rosaceae. Proc. Indian Acad. Sci., Pl. Sci. 100: 17–21.
CCDB · CromoCat 2015 — Singhal, V. K., B. S. Gill & M. S. Sidhu. (1990). Cytology of woody members of Rosaceae. Proc. Ind. Acad. Sci. B 100: 17-21.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type76 798 records
Wild obs. + sensor72 516
Museum / vouchered1 991
Cultivated / captive1 751
Other540
Origin
Native168
Introduced6 498
Range
Area of Occupancy AOO128 336 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 10 503≤1 km 10 859≤10 km 31 961>10 km 165
53 488 georeferenced · 19 028 without coordinates
Open the mapobservation + sensor72 516
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy69% within 1 km
≤100 m 372≤1 km 261≤10 km 249>10 km 35
917 georeferenced · 1 074 without coordinates
Open the institutions mapphysical evidence1 991
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤100 m 3≤1 km 1≤10 km 33>10 km 19
56 georeferenced · 1 695 without coordinates
Open the mapnot free-living1 751
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions94 of 171 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 167 |
| Görlitz, DE | 140 |
| BIO-UNIPIlocation not on record | 131 |
| DBF-NHMDlocation not on record | 113 |
| Olocation not on record | 97 |
| Karlsruhe, DE | 84 |
| Adelaide, AU | 73 |
| KMNlocation not on record | 67 |
| LDlocation not on record | 63 |
| WTUlocation not on record | 55 |
| Urumqi, CN | 41 |
| Beijing, CN | 38 |
| Moscow State Universitylocation not on record | 37 |
| Oskarshamn, SE | 31 |
| SLU Artdatabankenlocation not on record | 25 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 24 |
| Durango, MX | 23 |
| Yangling, CN | 23 |
| South Kensington, GB | 22 |
| Mlocation not on record | 21 |
| BClocation not on record | 20 |
| MeiseBGlocation not on record | 17 |
| Corvallis, US | 16 |
| BDBClocation not on record | 15 |
| Christchurch, NZ | 14 |
| AZE009location not on record | 14 |
| Helsinki, FI | 13 |
| MAlocation not on record | 12 |
| AZE015location not on record | 12 |
| Armidale, AU | 12 |
| Salzburg, AT | 12 |
| Ann Arbor, US | 12 |
| Auckland, NZ | 11 |
| BFLlocation not on record | 11 |
| Tula State Universitylocation not on record | 10 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 10 |
| ESP007location not on record | 10 |
| Saint Louis, US | 10 |
| Portland, US | 10 |
| València, ES | 9 |
| Wlocation not on record | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| Provincia di Livornolocation not on record | 9 |
| New Haven, US | 9 |
| Tlalnepantla, MX | 8 |
| Santa Barbara, US | 8 |
| Bronx, US | 8 |
| CICYTEXlocation not on record | 8 |
| Berlin, DE | 8 |
| Puebla, MX | 7 |
| Barcelona, ES | 7 |
| Museo Entomologico de Leonlocation not on record | 6 |
| San Francisco, US | 6 |
| Uppsala, SE | 6 |
| Moscow, US | 6 |
| Salamanca, ES | 5 |
| Tartu, EE | 5 |
| Universidad de Nariño (UdeNar)location not on record | 5 |
| Boise, US | 5 |
| Mount Annan, AU | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Bern, CH | 5 |
| Jyväskylä, FI | 5 |
| Bergen, NO | 5 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Tokushima, JP | 4 |
| Vitoria, ES | 4 |
| BRNUlocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| Puerto Ayora, EC | 3 |
| Badajoz, ES | 3 |
| Córdoba, AR | 3 |
| Angwin, US | 3 |
| Rotorua, NZ | 3 |
| Voronezh State Universitylocation not on record | 3 |
| Québec, CA | 3 |
| Canberra, AU | 3 |
| Toronto, CA | 3 |
| Kuopio, FI | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Montréal, CA | 3 |
| YUG047location not on record | 3 |
| UChlocation not on record | 3 |
| Vancouver, CA | 3 |
| University of New Hampshirelocation not on record | 3 |
| Tapachula, MX | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Wellington, NZ | 2 |
| National Museum Waleslocation not on record | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| Brasília, BR | 2 |
| Victoria, CA | 2 |
| Philadelphia, US | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| La Paz, BO | 2 |
| Kew, GB | 2 |
| Salvador, BR | 2 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Guatemala City, GT | 1 |
| Banyoles, ES | 1 |
| UERJlocation not on record | 1 |
| Chengdu, CN | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| EL PASO, US | 1 |
| Linares, MX | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Frankfurt am Main | 1 |
| Université Lavallocation not on record | 1 |
| Nijmegen, NL | 1 |
| Oulu, FI | 1 |
| UoB-IBlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Pamplona, ES | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| IANIGLAlocation not on record | 1 |
| Granada, ES | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Xian, CN | 1 |
| Zürich, CH | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Riverside, US | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| CJBGlocation not on record | 1 |
| Podgorica, ME | 1 |
| Bourges, FR | 1 |
| Jaén, ES | 1 |
| Hamilton, US | 1 |
| ISAlocation not on record | 1 |
| Mexico City, MX | 1 |
| Criciúma, BR | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Tampa, US | 1 |
| Cape Town, ZA | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Pretoria, ZA | 1 |
| GZUlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Gijón, ES | 1 |
| UIBlocation not on record | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Chapingo, MX | 1 |
| Wuzhou, CN | 1 |
| Kingston, US | 1 |
| PUC-RSlocation not on record | 1 |
| Bend, US | 1 |
| Pocatello, US | 1 |
| Chiba, JP | 1 |
| Austin, US | 1 |
| Claremont, US | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Trondheim, NO | 1 |
| Santiago de Compostela, ES | 1 |
| Austin, US | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
171 institutions · 1 861 of 1 991 vouchered records shown · 101 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA37 detections
Where the DNA of Prunus domestica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found37
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 37 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.0 °C 11.2–17.2
Seasonal swing summer↔winter16.1 °C
Max temp (day)18.9 °C 13.8–21.4
Min temp (night)12.0 °C 6.60–12.8
Precipitation78.2 mm/mo 50.7–110
Air humidity59.5 % 56.6–63.9
Moisture balance-25.8 mm/mo -72.1–37.5
Vapour deficit746 Pa 488–832
Wind speed3.20 m/s 2.50–4.60
Cloud cover48.2 % 39.8–53.3
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.