Prunella laciniata
(L.) L. · speciesAt a glance
Occurrence records41 104
Data sources9
Biological traits44
DNA specimens4
eDNA detections2
Sources9 archives
Databases and archives Prunella laciniata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility41 104 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources44 traits
Occurrence & distributionGBIF41 104 records
Environmental DNA1 datasets · 1 countries2 detections
DNA & barcodingBOLD · NCBI4 specimens
Genome at a glanceCCDB2n = 28
01Narrative
La Brunelle laciniée ou Brunelle blanche est une espèce de plantes à fleurs de la famille des Lamiacées. C'est une plante herbacée vivace trouvée en Europe, en Afrique du Nord, et en Asie, jusqu'en Iran. Elle a été introduite ailleurs en Amérique, au Royaume Uni et en Australie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology12
Fruit length2.25 mm
Leaf length32 mm
Leaf width20 mm
Petiole length2 cm
Plant height0.123 m
⚠ sources differ — GIFT: 0.123 m · LEDA: 0.145 m · TRY: 0.197 m
Plant height generative0.237 m
Plant height max0.4 m
Plant height min0.05 m
Seed length2.25 mm
Seed mass1.21 mg
Seed mass max1.24 mg
Seed mass min1.23 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typeanimal
Flowering endApr
Flowering startJun
Flowering timeyyyynnnnnnyy
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Habitat GIFTforest, meadows: dry, mountains, shrubberies, steppe, stony places
Leaf compoundnesssimple
Leaf shapeovate
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)211 mg/g
Leaf n18.81 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)16.81 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Plant support typefree-standing
Shoot orientationascending
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prunella laciniata has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes3
GenBank sequences2
eDNA detections2
Countries2
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCA …
Prunella laciniata voucher PLT.0663 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★trnL-F★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Prunella laciniata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records28–322n range28median28mode26records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2818×CCDB · ita-fl · CCDB · slov-fl · CCDB · nw-europe-fl +5
CCDB · ita-fl — KIEFT B., LOON J.C. - 1978. IOPB chromosome number reports LXII.. Taxon , 27(5/6): 524-525.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Váchová M., 1970a: Probleme und Bestimmung der Chromosomenzahlen bei den drei Grundarten der Gattung Prunella auf dem Gebiet der Slowakei. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 77-83.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3502
CCDB · fl-europaea — Kozuharov &
CCDB · ipcn-api-dl — KIEFT, B. & J. C. V. LOON. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn67-71 — KOZUHAROV, s., & B. KUZMANOV. 1969. Chromosome numbers of Bulgarian plants. 3. Genetika i Selektsiya 2: 181-185.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — VACHOVA, M. 1970. Probleme und Bestimmung der Chromosomenzahlen bei den drei Grundarten der Gattung Prunella auf dem Gebiet der Slowakei. Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16: 77-83.
CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.
CCDB · CromoCat 2015 — Kieft, B. & van Loon, J. C. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 524-525.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Morton, J. K. (1973). A cytological study of the British Labiatae (excluding Mentha). Watsonia 9: 239-246.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
CCDB · CromoCat 2015 — Váchová, M. (1970). Probleme und bestimmung der chromosomenzahlen bei den drei grundarten der gattung Prunella auf dem gebiet der slowakei. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 16: 77-83.
CCDB · CromoCat 2015 — Kozuharov, S. & Kuzmanov, B. (1969). Chromosome numbers of Bulgarian plants. 3. Genet. Selekts. 2(3): 181-185.
2n 326×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-fedorov +2
CCDB · fl-europaea — Majovsky et al.,
CCDB · ipcn-api-dl — Jasiewicz, A. & M. Mizianty. 1975. Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 21: 277–288.
CCDB · book-fedorov — Hruby 1932a
CCDB · book-atlas-flowering-plants — Eur., W. Asia, N.
CCDB · CromoCat 2015 — Hruby, K. (1932). Cytologie a anatomie ceskoslovenskych Brunell. Preslia 11: 40-44.
CCDB · CromoCat 2015 — Jasiewicz, A. & Mizianty, M. (1975). Chromosome numbers of some Bulgarian plants. Fragm. Florist. Geobot. 12: 277-288.
2n 302×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribution a l'tude citotaxonomique des spermatophyta du Portugal. XVIII. Lamiaceae Fernandes, A. & M. T. Leitao.Mem. Soc. Brot.27: 27-75(1985).
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1984). Contribution a l'étude citotaxonomique des Spermatophyta du Portugal. XVIII. Lamiaceae. Mem. Soc. Brot. 27: 27-75.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type41 104 records
Wild obs. + sensor38 976
Museum / vouchered1 784
Cultivated / captive5
Other339
Origin
Native338
Introduced119
Range
Area of Occupancy AOO65 704 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 5 556≤1 km 1 745≤10 km 20 766>10 km 203
28 270 georeferenced · 10 706 without coordinates
Open the mapobservation + sensor38 976
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 61≤1 km 364≤10 km 292>10 km 4
721 georeferenced · 1 063 without coordinates
Open the institutions mapphysical evidence1 784
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 1≤10 km 1
2 georeferenced · 3 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions49 of 104 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 338 |
| Berlin, DE | 154 |
| MeiseBGlocation not on record | 131 |
| València, ES | 85 |
| Moscow State Universitylocation not on record | 68 |
| Entomological Society of Latvialocation not on record | 54 |
| GJOlocation not on record | 54 |
| LDlocation not on record | 52 |
| BFLlocation not on record | 51 |
| Lausanne, CH | 45 |
| MAlocation not on record | 42 |
| BDBClocation not on record | 38 |
| Vitoria, ES | 37 |
| BClocation not on record | 35 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 34 |
| Wlocation not on record | 33 |
| Salamanca, ES | 30 |
| Pamplona, ES | 29 |
| Bern, CH | 28 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 22 |
| BRNUlocation not on record | 19 |
| College of the Atlantic, Museumlocation not on record | 19 |
| Madrid, ES | 18 |
| Barcelona, ES | 18 |
| Porrentruy, CH | 14 |
| Museo Entomologico de Leonlocation not on record | 13 |
| CICYTEXlocation not on record | 13 |
| CJBGlocation not on record | 12 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| South Kensington, GB | 9 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 9 |
| Auckland, NZ | 8 |
| Philadelphia, US | 8 |
| GZUlocation not on record | 7 |
| Christchurch, NZ | 7 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 7 |
| Sevilla, ES | 7 |
| Hobart, AU | 7 |
| Badajoz, ES | 7 |
| Granada, ES | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Pamplona, ES | 6 |
| Alicante, ES | 5 |
| US | 5 |
| Mlocation not on record | 5 |
| Podgorica, ME | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Oskarshamn, SE | 5 |
| Mount Annan, AU | 5 |
| ER Hellerlocation not on record | 4 |
| Görlitz, DE | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| ISAlocation not on record | 4 |
| JBSlocation not on record | 4 |
| Jaén, ES | 3 |
| Provincia di Livornolocation not on record | 3 |
| OLAlocation not on record | 3 |
| PRClocation not on record | 3 |
| Salzburg, AT | 3 |
| BSBIlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| LfUlocation not on record | 2 |
| Zürich, CH | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| UGentlocation not on record | 2 |
| Regensburgische Botanische Gesellschaftlocation not on record | 2 |
| Denver, US | 2 |
| Paris, FR | 2 |
| Bourges, FR | 2 |
| Bronx, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| UIBlocation not on record | 1 |
| Canberra, AU | 1 |
| Québec, CA | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Córdoba, ES | 1 |
| Fulda, DE | 1 |
| ULBF-AGRlocation not on record | 1 |
| Kew, GB | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Stockholm, SE | 1 |
| Boumlocation not on record | 1 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 1 |
| CIBIOlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Uppsala, SE | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Bangkok, TH | 1 |
| ER-Gaucklocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Dresden, DE | 1 |
| ESP109location not on record | 1 |
| Zürich, CH | 1 |
| Xiamen, CN | 1 |
| Wellington, NZ | 1 |
| Sion, CH | 1 |
| Brisbane, AU | 1 |
| Montréal, CA | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Göteborg, SE | 1 |
104 institutions · 1 714 of 1 784 vouchered records shown · 70 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA2 detections
Where the DNA of Prunella laciniata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.6 °C 19.6–19.6
Seasonal swing summer↔winter16.6 °C
Max temp (day)25.2 °C
Min temp (night)12.7 °C
Precipitation33.6 mm/mo
Air humidity53.2 %
Moisture balance-124 mm/mo
Vapour deficit1,068 Pa
Wind speed2.40 m/s
Cloud cover35.3 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.