Prumnopitys montana

(Humb. & Bonpl. ex Willd.) de Laub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Prumnopitys

At a glance

Occurrence records334

Data sources9

Biological traits22

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Prumnopitys montana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility334 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF334 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Prumnopitys montana is a species of conifer in the family Podocarpaceae. It is found in Colombia, Ecuador, Peru, and Venezuela. The Latin specific epithet montana refers to mountains or coming from mountains.Archibald William Smith

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height15 m

Plant height max30 m

Seed mass55.56 mg

Seed mass max55.56 mg

Seed mass min55.56 mg

Life cycle & reproduction7

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max3 600 m

Elevation min1 800 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition9 compounds

Compounds documented for Prumnopitys montana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones9

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
5-Hydroxy-8-[2-hydroxy-5-(5-hydroxy-7-methoxy-4-oxo-2,3-dihydrochromen-2-yl)phenyl]-7-methoxy-2-(4-methoxyphenyl)chromen-4-one	present	LOTUS
Amentoflavone	present	LOTUS
Bilobetin	present	LOTUS
Heveaflavone	present	LOTUS
Hinokiflavone	present	LOTUS
Podocarpusflavone A	present	LOTUS
Podocarpusflavone B	present	LOTUS
Sciadopitysin	present	LOTUS
Sequoiaflavone	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prumnopitys montana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLJF969746.1 ↗574 bp

ACGT

AAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGACCCAAGAGACTGATATCTTGGCAGC …

Prumnopitys montana isolate PrMo612 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

08Occurrence & distribution

Record type334 records

Wild obs. + sensor93

Museum / vouchered236

Cultivated / captive1

Fossil4

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤1 km 1>10 km 84

85 georeferenced · 8 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 20>10 km 12

34 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence236

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	50
Loja, EC	20
Universiti Sains Malaysialocation not on record	18
Universidad Nacional de Colombia (UNAL)location not on record	14
Universidad del Quindío (UniQuindío)location not on record	11
UTPLlocation not on record	10
Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record	9
HUT Culture Collectionlocation not on record	9
Kew, GB	8
Bronx, US	7
Xiamen, CN	6
Aarhus, DK	6
Lima, PE	5
Göteborg, SE	5
Edinburgh, GB	5
Christchurch, NZ	4
Universidad de Caldas (UCaldas)location not on record	4
Altos de Pipe, VE	4
Canadian Department of Agriculturelocation not on record	4
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
QCNElocation not on record	3
Iquitos, PE	3
Cuenca, EC	3
Stockholm, SE	2
Fort Worth, US	2
HUAlocation not on record	2
IAvHlocation not on record	1
Universidad Católica de Oriente (UCO)location not on record	1
Chicago, US	1
Universidad de La Salle (La Salle)location not on record	1
Wlocation not on record	1
Universidad Distrital Francisco José de Caldas (UDistrital)location not on record	1
Riverside, US	1
Uppsala, SE	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1

35 institutions · 227 of 236 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Prumnopitys montana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)