Prumnopitys ladei

(F.M.Bailey) de Laub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Prumnopitys

At a glance

Occurrence records152

Data sources10

Biological traits22

DNA specimens11

eDNA detections11

Sources10 archives

Databases and archives Prumnopitys ladei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~5.48 Gbp↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF152 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceGoaT5.5 Gbp

01Narrative

Prumnopitys ladei é uma espécie de conífera da família Podocarpaceae. Apenas pode ser encontrada na Austrália.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology7

Fruit length27.5 mm

Fruit width22.5 mm

Leaf length14 mm

Leaf width2.5 mm

Plant height33 m

Seed length20 mm

Seed width14 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typestrobilus

Growth formtree

Leaf compoundnesssimple

Leaf shapeoblong

Woodinesswoody

Physiology & chemistry1

Wood density607 mg/cm³

03Chemical composition1 compounds

Compounds documented for Prumnopitys ladei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pimarane and Isopimarane diterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Isopimara-7,15-diene		present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prumnopitys ladei has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences10

eDNA detections11

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF714020.1 ↗420 bp

ACGT

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCGAGGGCACGTCTGCCTGGGCGACGCACTTCCA …

Prumnopitys ladei isolate P609 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Prumnopitys ladei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 476 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Prumnopitys ladei5.48 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type152 records

Wild obs. + sensor8

Museum / vouchered143

Cultivated / captive1

Origin

Native8

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 7 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 23≤1 km 35≤10 km 37

95 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence143

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	54
Brisbane, AU	32
Canberra, AU	12
Mount Annan, AU	8
Kew, GB	6
Museo Entomologico de Leonlocation not on record	5
James Cook Townsvillelocation not on record	3
Edinburgh, GB	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Parkville, AU	1
Canadian Department of Agriculturelocation not on record	1
Australian Tropical Herbariumlocation not on record	1
Saint Louis, US	1
Auckland, NZ	1
Christchurch, NZ	1

15 institutions · 129 of 143 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Prumnopitys ladei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–22.6

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C 26.1–28.5

Min temp (night)15.0 °C 15.0–18.8

Precipitation15.6 mm/mo 15.6–204

Air humidity43.4 % 43.4–65.5

Moisture balance-143 mm/mo -143–35.7

Vapour deficit1,624 Pa 968–1,624

Wind speed4.00 m/s 2.30–4.00

Cloud cover18.1 % 18.1–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)