Prumnopitys ferruginea

(G.Benn. ex D.Don) de Laub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Prumnopitys

At a glance

Occurrence records379

Data sources14

Biological traits42

DNA specimens6

eDNA detections6

Sources14 archives

Databases and archives Prumnopitys ferruginea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility379 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources42 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF379 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT7.7 Gbp

01Narrative

Il miro è una conifera sempreverde della famiglia Podocarpaceae, endemica della Nuova Zelanda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology17

Fruit length18 mm

Fruit width12 mm

Leaf length max20 mm

Leaf width2 mm

Leaf width max2 mm

Leaf width min2 mm

Plant height20 m

⚠ sources differ — GIFT: 20 m · TRY: 11 m

Plant height max30 m

Seed length12 mm

Seed length max12 mm

Seed length min12 mm

Seed mass485 mg

Seed mass max666 mg

Seed mass min196 mg

Seed width10 mm

Seed width max10 mm

Seed width min10 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Life spanperennial

Lifespan years500 years

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Reproduction asexualabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTCoastal

Mycorrhizaabsent

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry7

Leaf dry-matter content (LDMC)404 mg/g

Leaf n8.83 mg/g

Leaf p0.611 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.4 mm²/mg

Wood density556 mg/cm³

03Chemical composition28 compounds

Compounds documented for Prumnopitys ferruginea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abietane diterpenoids6

Abietane diterpenoids $ Podocarpane diterpenoids4

Totarane diterpenoids2

Podocarpane diterpenoids2

Oleanane triterpenoids2

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Royleanone	present	LOTUS
(4aS)-6-hydroxy-1,1,4a-trimethyl-7-propan-2-yl-3,4-dihydro-2H-phenanthren-9-one	present	LOTUS
(4aS,10aS)-6-hydroxy-1,1,4a-trimethyl-7-propan-2-yl-4,9,10,10a-tetrahydro-2H-phenanthren-3-one	present	LOTUS
(4aS,10aS)-6-methoxy-1,1,4a-trimethyl-7-propan-2-yl-3,4,10,10a-tetrahydro-2H-phenanthren-9-one	present	LOTUS
(4bS,8aS)-3-[(4bS,8aS)-2-hydroxy-4b,8,8-trimethyl-1-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-3-yl]-4b,8,8-trimethyl-1-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-2-ol	present	LOTUS
(4bS,8S,8aR)-8-(hydroxymethyl)-4b,8-dimethyl-2-propan-2-yl-5,6,7,8a,9,10-hexahydrophenanthren-3-ol	present	LOTUS
1-Octacosanol	present	NPASS
1-Phenanthrenemethanol, 7-ethenyl-1,2,3,4,4a,4b,5,6,7,8,10,10a-dodecahydro-1,4a,7-trimethyl-, (1R,4aR,4bS,7S,10aR)-	present	LOTUS
12-Hydroxy-5beta-abieta-8,11,13-triene-6,7-dione	present	LOTUS
16-Hydroxytotarol	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prumnopitys ferruginea has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences7

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF714018.1 ↗419 bp

ACGT

TGCAGAATCCCGTGAATATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCGAGGGCACGTCTGCCTGGGCGACGCACTTCCAT …

Prumnopitys ferruginea isolate P600 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Prumnopitys ferruginea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size7 726 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Prumnopitys ferruginea7.73 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidy2× diploid · measured

Chromosome records36–362n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 364×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · ipcn-api-dl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — Davies, B. J., I. E. W. O'Brien & B. G. Murray. 1997. Karyotypes, chromosome bands and genome size variation in New Zealand endemic gymnosperms. Pl. Syst. Evol. 208: 169–185.

CCDB · Cave1958 — Hair & Beuzen. 1958a,b

n 181×CCDB · Cave1958

CCDB · Cave1958 — Hair & Beuzen. 1958a,b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.980 ↗

08Occurrence & distribution

Record type379 records

Wild obs. + sensor148

Museum / vouchered224

Cultivated / captive7

Origin

Native62

Introduced1

Range

Area of Occupancy AOO1 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 147 without coordinates

Open the mapobservation + sensor148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 5≤1 km 15≤10 km 7>10 km 2

29 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence224

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 6 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	105
Wellington, NZ	77
Kew, GB	9
Hobart, AU	5
Palmerston North, NZ	5
John T. Waterhouse Herbariumlocation not on record	4
Museo Entomologico de Leonlocation not on record	2
Mount Annan, AU	2
Smithfield, AU	2
Armidale, AU	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Christchurch, NZ	1
Saint Louis, US	1
Chongqing Museumlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Uppsala, SE	1
HAWlocation not on record	1
Edinburgh, GB	1

18 institutions · 221 of 224 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Prumnopitys ferruginea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)