Provanna macleani

Warén & Bouchet, 1989 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Provannidae/Provanna

At a glance

Occurrence records20

Data sources8

Biological traits0

DNA specimens6

eDNA detections12

Sources8 archives

Databases and archives Provanna macleani's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS20 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD6 specimens

01Narrative

Provanna macleani is a species of sea snail, a marine gastropod mollusk in the family Provannidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Provanna macleani has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes2

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P527 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Diversity (π)7.1%

Haplotypes2

BINs2

Most divergent pair17.6%

Where individuals differ — all 93 variable positions, in barcode order

3Tmostly conserved

9Tmostly conserved

10Cmostly conserved

12Tmostly conserved

13Tmostly conserved

15Amostly conserved

21Cmostly conserved

24Tmostly conserved

27Amostly conserved

30Cmostly conserved

39Amostly conserved

45Tmostly conserved

57Tmostly conserved

63Tmostly conserved

76Tmostly conserved

78Amostly conserved

81Amostly conserved

84Gmostly conserved

87Amostly conserved

93Amostly conserved

111Cmostly conserved

120Tmostly conserved

123Tmostly conserved

129Amostly conserved

130Tmostly conserved

135Amostly conserved

141Amostly conserved

159Amostly conserved

160Cmostly conserved

162Tmostly conserved

180Gmostly conserved

184Tmostly conserved

186Amostly conserved

189Tmostly conserved

195Tmostly conserved

196Cmostly conserved

198Gmostly conserved

199Cmostly conserved

201Tmostly conserved

202Tmostly conserved

205Tmostly conserved

207Amostly conserved

210Gmostly conserved

216Amostly conserved

219Tmostly conserved

222Amostly conserved

234Amostly conserved

236Cmostly conserved

240Amostly conserved

243Cmostly conserved

252Amostly conserved

255Amostly conserved

261Gmostly conserved

264Amostly conserved

268Gmostly conserved

273Tmostly conserved

276Tmostly conserved

277Tmostly conserved

285Tmostly conserved

291Gmostly conserved

300Cmostly conserved

309Amostly conserved

319Cmostly conserved

321Tmostly conserved

324Cmostly conserved

351Tmostly conserved

393Amostly conserved

396Amostly conserved

399Gmostly conserved

408Amostly conserved

429Amostly conserved

432Amostly conserved

448Amostly conserved

451Cmostly conserved

453Tmostly conserved

460Tmostly conserved

462Amostly conserved

465Tmostly conserved

466Cmostly conserved

468Tmostly conserved

474Gmostly conserved

475Cmostly conserved

477Amostly conserved

480Tmostly conserved

486Cmostly conserved

492Amostly conserved

495Amostly conserved

498Amostly conserved

499Tmostly conserved

504Gmostly conserved

513Cmostly conserved

516Tmostly conserved

525Amostly conserved

CCTGGTGCTCTTTTAGGAGACGATCAACTCTATAATGTAATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTTTAGTAATGCCAATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Provanna cookisame genus7.4%Provanna laevissame genus7.7%Provanna iossame genus8.7%Provanna variabilissame genus9.1%Polinices mammillasame order13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type20 records

Museum / vouchered12

Other8

Range

Area of Occupancy AOO36 km²

Depth

0–200 m sunlit0

200–1000 m twilight0

1–4 km midnight4

>4 km abyssal0

median 2 680.5 m · max 2 750 m · 4 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	5
Stockholm, SE	2
Los Angeles, US	2
Paris, FR	1

4 institutions · 10 of 12 vouchered records shown · 2 without an institution code

09Environmental DNA12 detections

Where the DNA of Provanna macleani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 13.0–13.0

Seasonal swing summer↔winter3.30 °C

Max temp (day)13.7 °C

Min temp (night)12.5 °C

Precipitation53.9 mm/mo

Air humidity71.4 %

Vapour deficit423 Pa

Cloud cover36.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)