Proteoteras moffatiana

Fernald, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Proteoteras

At a glance

Occurrence records414

Data sources8

Biological traits0

DNA specimens23

eDNA detections22

Sources8 archives

Databases and archives Proteoteras moffatiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF414 records

Environmental DNA1 datasets · 2 countries22 detections

DNA & barcodingBOLD23 specimens

01Narrative

Proteoteras moffatiana, known generally as the gray-flanked proteotera or maple shoot borer, is a species of tortricid moth in the family Tortricidae. The MONA or Hodges number for Proteoteras moffatiana is 3235. Gray-flanked proteoteras, Proteoteras moffatiana

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Proteoteras moffatiana has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAATTGGTACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Proteoteras naracanasame genus5.5%Proteoteras crescentanasame genus6.1%Proteoteras obnigranasame genus6.2%Proteoteras willinganasame genus6.2%Proteoteras aesculanasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type414 records

Wild obs. + sensor322

Museum / vouchered92

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 198≤1 km 44≤10 km 9>10 km 13

264 georeferenced · 58 without coordinates

Open the mapobservation + sensor322

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 9≤1 km 1≤10 km 19>10 km 1

30 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	34
Mississippi State, US	14
New Haven, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Washington, US	5
ASUlocation not on record	5
East Lansing, US	5
Cambridge, US	4
SOVTlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

10 institutions · 84 of 92 vouchered records shown · 8 without an institution code

09Environmental DNA22 detections

Where the DNA of Proteoteras moffatiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map2 countries0

Mixed HabitatMixed habitatForestTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 16.9–21.1

Seasonal swing summer↔winter28.8 °C

Max temp (day)24.7 °C 19.2–25.9

Min temp (night)15.8 °C 13.8–16.8

Precipitation95.1 mm/mo 79.6–123

Air humidity59.8 % 57.6–63.2

Moisture balance-48.9 mm/mo -69.1–-17.0

Vapour deficit938 Pa 684–1,020

Wind speed2.60 m/s 2.20–3.20

Cloud cover42.5 % 39.0–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)