Protatlanta souleyeti

(E.A.Smith, 1888) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Atlantidae/Protatlanta

At a glance

Occurrence records234

Data sources7

Biological traits5

DNA specimens101

eDNA detections58

Sources7 archives

Databases and archives Protatlanta souleyeti's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

OBISOcean Biodiversity Information System116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics101 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS234 records

Environmental DNA1 datasets · 6 countries58 detections

DNA & barcodingBOLD101 specimens

01Narrative

Protatlanta souleyeti is a species of sea snail, a holoplanktonic marine gastropod mollusk in the family Atlantidae. Protatlanta souleyeti is the type species on the genus Protatlanta. It is considered to be the only Recent species on the genus. The specific name souleyeti is in honor of French malacologist Louis François Auguste Souleyet. apertural view of protoconch of Protatlanta souleyeti from the Pliocene

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length0.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits2

Depth max300 m

Depth min0 m

05DNA & barcoding101 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protatlanta souleyeti has left across the world's sequence archives.

At a glance

DNA specimens101

BINs2

Marker genes3

eDNA detections58

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

7Amostly conserved

20Gmostly conserved

28Amostly conserved

88Gmostly conserved

94Gmostly conserved

97Cmostly conserved

115Tmostly conserved

166Amostly conserved

178Tmostly conserved

197Cmostly conserved

202Tmostly conserved

235Cmostly conserved

262Gmostly conserved

271Tmostly conserved

353Amostly conserved

379Cmostly conserved

421Cvariable

506Gmostly conserved

511Amostly conserved

530Gmostly conserved

562Gmostly conserved

601Tmostly conserved

631Gmostly conserved

649Amostly conserved

655Cmostly conserved

GACTTTATATATTTTATTTGGTATATGATCCGGCCTTGTAGGTACTGCTCTTAGGCTTTTAATTCGAGCTGAATTAGGTCAACCGGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes10

BINs2

Most divergent pair3.3%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Turritella terebrasame order17.2%Turritella bacillumsame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S28S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type234 records

Wild obs. + sensor44

Museum / vouchered188

Cultivated / captive1

Other1

Range

Area of Occupancy AOO600 km²

Depth

0–200 m sunlit44

200–1000 m twilight3

1–4 km midnight42

>4 km abyssal4

median 912 m · max 4 766 m · 93 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 44 records without

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 21≤1 km 5≤10 km 3>10 km 2

31 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence188

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	31
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	10
Natural History Museum Rotterdamlocation not on record	9
Naturalis Biodiversity Centerlocation not on record	6
Wellington, NZ	6
Copenhagen, DK	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	3
Brussels, BE	3
Israel Oceanographic & Limnological Research, Ltd. The National Institute of Oceanographylocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
Tapachula, MX	1
Washington, US	1
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	1
Chicago, US	1

16 institutions · 85 of 188 vouchered records shown · 32 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA58 detections

Where the DNA of Protatlanta souleyeti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 16.9–23.8

Seasonal swing summer↔winter6.00 °C

Max temp (day)21.1 °C 17.9–24.3

Min temp (night)19.8 °C 16.1–23.2

Precipitation91.4 mm/mo 30.1–150

Air humidity59.5 % 58.2–60.7

Vapour deficit978 Pa 767–1,175

Cloud cover34.8 % 22.6–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 58 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)