Protanthea simplex

Carlgren, 1891 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Gonactiniidae/Protanthea

At a glance

Occurrence records7 798

Data sources8

Biological traits2

DNA specimens4

eDNA detections8

Sources8 archives

Databases and archives Protanthea simplex's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 222 records↗

OBISOcean Biodiversity Information System3 576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS7 798 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD4 specimens

01Narrative

Protanthea simplex is a species of sea anemone found in deep water off the coasts of north west Europe. It is the only species in the monotypic genus Protanthea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protanthea simplex has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

7Avariable

AACATTATATTTAGTCTTTGGAATAGGATCCGGTATGATAGGCACAGCGTTAAGCATGTTAATAAGATTGGAATTATCCGCCCCCGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cylista eleganssame order9.4%Sagartia undatasame order9.4%Cereus pedunculatussame order9.8%Metridium farcimensame order9.9%Metridium senilesame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 798 records

Wild obs. + sensor6 395

Museum / vouchered1 223

Other180

Range

Area of Occupancy AOO1 820 km²

Depth

0–200 m sunlit969

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 15.5 m · max 360 m · 971 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 2 053≤1 km 76≤10 km 3 975>10 km 4

6 108 georeferenced · 287 without coordinates

Open the mapobservation + sensor6 395

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 11≤1 km 7≤10 km 6

24 georeferenced · 1 199 without coordinates

Open the institutions mapphysical evidence1 223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	18
Stockholm, SE	9
ARMS-MBONlocation not on record	7
Gothenburg, SE	5
South Kensington, GB	3
SLU Artdatabankenlocation not on record	3
730location not on record	2
University of Oslo (UiO)location not on record	2
MZLUlocation not on record	2
DASSHlocation not on record	1
Goteborg Natural History Museumlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
PNHSlocation not on record	1

13 institutions · 55 of 1 223 vouchered records shown · 31 without an institution code

09Environmental DNA8 detections

Where the DNA of Protanthea simplex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Marina/Harbour; semi-industrial; 9.6 - Subti…Mixed bottomMarine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.00 °C 6.00–24.0

Seasonal swing summer↔winter17.1 °C

Max temp (day)8.00 °C 8.00–28.2

Min temp (night)3.60 °C 3.60–19.5

Precipitation47.0 mm/mo 15.6–58.1

Air humidity60.4 % 56.3–60.9

Moisture balance-25.3 mm/mo -123–-25.3

Vapour deficit370 Pa 370–1,298

Wind speed5.40 m/s 3.10–5.40

Cloud cover44.3 % 17.4–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Protanthea simplex

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type7 798 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 798 records