Protalebrella brasiliensis

(Baker, 1899) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Protalebrella

At a glance

Occurrence records724

Data sources6

Biological traits0

DNA specimens66

eDNA detections179

Sources6 archives

Databases and archives Protalebrella brasiliensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility724 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI179 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics66 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF724 records

Environmental DNA1 datasets · 8 countries179 detections

DNA & barcodingBOLD66 specimens

01Narrative

Protalebrella brasiliensis, the Brazilian leafhopper, is a species of leafhopper in the family Cicadellidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding66 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protalebrella brasiliensis has left across the world's sequence archives.

At a glance

DNA specimens66

BINs1

Marker genes1

eDNA detections179

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

245Cvariable

338Cmostly conserved

377Cvariable

476Avariable

629Tmostly conserved

CAATATACTTCATTTTTGGAATTTGATCCGGAATAGTTGGTATAATACTTAGAATATTAATTCGAGTAGAACTAGCACAACCTGGGTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.34%

Haplotypes7

BIN1

Most divergent pair1.1%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dikraneura sitkanasame family17.1%Dikraneura malisame family17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type724 records

Wild obs. + sensor576

Museum / vouchered148

Range

Area of Occupancy AOO1 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 321≤1 km 76≤10 km 27>10 km 65

489 georeferenced · 87 without coordinates

Open the mapobservation + sensor576

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 148 records without

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
North Carolina State University Insect Museumlocation not on record	46
National Biodiversity Institute, Costa Ricalocation not on record	44
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	16
Centre for Biodiversity Genomicslocation not on record	11
Mexico City, MX	7
University of Central Floridalocation not on record	7
Champaign, US	4
Mangilao, GU	4
OSUClocation not on record	2

9 institutions · 141 of 148 vouchered records shown · 7 without an institution code

09Environmental DNA179 detections

Where the DNA of Protalebrella brasiliensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found179

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 179 detections have coordinates

Open the map8 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 20.6–25.7

Seasonal swing summer↔winter5.00 °C

Max temp (day)25.1 °C 23.7–27.8

Min temp (night)18.9 °C 17.1–24.1

Precipitation147 mm/mo 48.7–332

Air humidity69.2 % 60.9–76.7

Moisture balance18.5 mm/mo -80.7–218

Vapour deficit882 Pa 599–1,198

Wind speed2.20 m/s 0.5–4.40

Cloud cover33.3 % 23.7–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 179 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)