Protaetia fusca

(Herbst, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Protaetia

At a glance

Occurrence records1 555

Data sources7

Biological traits0

DNA specimens15

eDNA detections8

Sources7 archives

Databases and archives Protaetia fusca's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 555 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 555 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD15 specimens

01Narrative

Protaetia fusca is a beetle belonging to the Cetoniinae subfamily.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protaetia fusca has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

4Amostly conserved

7Gmostly conserved

16Amostly conserved

AACATTGTATTTTTTATTCGGAAGATGAGCAGGAATAGTAGGAACATCCCTTAGTCTACTAATTCGAGCTGAACTTGGAAACCCCGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Protaetia viduasame genus9.5%Protaetia ungaricasame genus9.6%Heterocnemis graecasame family10.7%Protaetia afflictasame genus11.0%Protaetia cupreasame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 555 records

Wild obs. + sensor1 285

Museum / vouchered269

Other1

Range

Area of Occupancy AOO4 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 544≤1 km 173≤10 km 90>10 km 169

976 georeferenced · 309 without coordinates

Open the mapobservation + sensor1 285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 1≤1 km 37≤10 km 22

60 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence269

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	108
The University of Hawaii Insect Museumlocation not on record	38
QVMAGlocation not on record	30
Mangilao, GU	22
Museums Victorialocation not on record	18
Natick, US	16
Wichita State Universitylocation not on record	7
Laboratoire Biométrie et Biologie Evolutive, University Lyon 1location not on record	7
Universite Claude Bernard Lyon 1location not on record	6
Sydney, AU	5
ASUlocation not on record	3
OSUClocation not on record	1
Gump Stationlocation not on record	1

13 institutions · 262 of 269 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Protaetia fusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 21.3–26.9

Seasonal swing summer↔winter7.90 °C

Max temp (day)27.9 °C 23.6–28.6

Min temp (night)22.2 °C 18.9–25.1

Precipitation143 mm/mo 73.1–244

Air humidity60.9 % 59.1–65.0

Moisture balance-38.3 mm/mo

Vapour deficit1,215 Pa 1,025–1,272

Wind speed3.50 m/s

Cloud cover40.1 % 21.1–59.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Protaetia fusca

At a glance

Sources7 archives

At a glance

Record type1 555 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 555 records