Protaetia aurichalcea

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Protaetia

At a glance

Occurrence records388

Data sources9

Biological traits0

DNA specimens8

eDNA detections6

Sources9 archives

Databases and archives Protaetia aurichalcea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility388 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF388 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Protaetia aurichalcea is a species of flower-chafer beetle in the family Scarabaeidae. It is found in Asia. The ground colour of the beetle is bronze with white markings on the elytra. Males have spines apical elytral angles. Like other flower-beetles, adults visit flowers but they are known to sometimes visit bee hives and feed on pollen collected.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Protaetia aurichalcea has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

31Tmostly conserved

79Amostly conserved

224Gmostly conserved

240Gmostly conserved

297Gmostly conserved

300Gmostly conserved

312Gmostly conserved

317Gmostly conserved

343Cmostly conserved

346Cmostly conserved

354Gmostly conserved

370Tmostly conserved

372Gmostly conserved

383Gmostly conserved

399Gmostly conserved

433Tmostly conserved

454Tmostly conserved

456Tmostly conserved

468Gmostly conserved

487Cvariable

538Tmostly conserved

553Tmostly conserved

560Gmostly conserved

565Amostly conserved

591Gmostly conserved

628Tmostly conserved

631Tmostly conserved

632Gmostly conserved

637Amostly conserved

AACTTTATATTTCCTATTTGGCAGATGAGCTGGAATAGTAGGAACATCCCTTAGCTTACTAATCCGAGCCGAACTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes4

BINs2

Most divergent pair4.1%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Protaetia cupreasame genus11.1%Protaetia ungaricasame genus11.1%Protaetia angustatasame genus12.0%Protaetia speciosasame genus12.2%Protaetia viduasame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Protaetia aurichalcea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Dutrillaux AM, Dutrillaux B (2012) Chromosome analysis of 82 species of Scarabaeoidea (Coleoptera), with special focus on NOR localization. Cytogenet Genome Res 136: 208-219. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type388 records

Wild obs. + sensor384

Museum / vouchered4

Range

Area of Occupancy AOO1 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 147≤1 km 75≤10 km 28>10 km 35

285 georeferenced · 99 without coordinates

Open the mapobservation + sensor384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University Park, US	2
Cape Town, ZA	1

2 institutions · 3 of 4 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Protaetia aurichalcea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.3–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 28.4–30.5

Min temp (night)19.3 °C 19.3–20.1

Precipitation109 mm/mo 95.9–109

Air humidity52.0 % 52.0–58.7

Moisture balance-17.8 mm/mo -55.1–-17.8

Vapour deficit1,616 Pa 1,272–1,616

Wind speed1.80 m/s 1.80–4.30

Cloud cover25.2 % 25.2–62.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)