Prosartes smithii

(Hook.) Utech, Shinwari & Kawano · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Prosartes

At a glance

Occurrence records3 299

Data sources12

Biological traits14

DNA specimens5

eDNA detections4

Sources12 archives

Databases and archives Prosartes smithii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 299 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF3 299 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT3 Gbp

01Narrative

Prosartes smithii is a North American species of flowering plants known by the common name largeflower fairybells. It is native to western North America from Vancouver Island in British Columbia south as far as Monterey County in California. It grows in shady forest and woodland, including redwood forests.Biota of North America Program 2014 county distribution mapCalflora taxon report, Prosartes smithii (Hook.) Utech, Shinwari & Kawano largeflower fairybells Prosartes smithii is an erect, branching perennial herb growing up to 1 m tall. Its narrow, fuzzy stems bear wide, oval-shaped, pointed leaves up to 12 cm long and mostly hairless. The inflorescence produces up to seven drooping, hanging flowers which may be hidden in the cover of the large leaves. The flower is cylindrical to bell-shaped with six white to green-tinged tepals each up to 3 cm long. The fruit is an oval-shaped orange or red berry just over 1 cm long.Flora of North AmericaJepson Manual Treatment Birmingham Botanical Gardens (United Kingdom)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass22.56 mg

Seed mass max23.65 mg

Seed mass min23.65 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prosartes smithii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX678794.1 ↗552 bpCanada · 2011

ACGT

AGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACAAAAGATACTGATATCTTGGCAGCA …

Prosartes smithii voucher ERM487 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Prosartes smithii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 012 589 285 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Prosartes smithii3.01 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 166×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · eflora +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Tamura, M. N., F. H. Utech & S. Kawano. 1992. Biosystematic studies in Disporum (Liliaceae---Polygonateae) IV. Karyotype analysis of some Asiatic and North American taxa with special reference to their systematic status. Pl. Spec. Biol. 7: 103–120.

CCDB · eflora

CCDB · book-atlas-flowering-plants — Jones 1951

CCDB · kew — Leitch IJ, Beaulieu JM, Cheung K, Hanson L, Lysak M, Fay MF. 2007. Punctuated genome size evolution in Liliaceae. Journal of Evolutionary Biology 20: 2296-2308.

CCDB · Cave1956 — Therman

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CAVE, M.S. 1970. Chromosomes of California Liliaceae. Univ. Calif. Publ. Bot. 57: 1-58.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 299 records

Wild obs. + sensor3 050

Museum / vouchered248

Cultivated / captive1

Range

Area of Occupancy AOO4 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 722≤1 km 435≤10 km 262>10 km 110

2 529 georeferenced · 521 without coordinates

Open the mapobservation + sensor3 050

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 22≤1 km 92≤10 km 47>10 km 12

173 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence248

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	69
Arcata, US	49
Pullman, US	38
Tacoma, US	14
Vancouver, CA	11
Chongqing Museumlocation not on record	8
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	6
WTUlocation not on record	6
Portland, US	6
Santa Barbara, US	5
Boise, US	4
Wuzhou, CN	3
Moscow, US	3
Bloomington, US	3
Davis, US	3
CASlocation not on record	2
US	2
Long Beach, US	2
Bend, US	2
San Diego, US	2
Claremont, US	1
Denver, US	1
Northridge, US	1
Ashland, US	1
Saint Louis, US	1
Tempe, US	1
University of Stellenboschlocation not on record	1
HJAEFlocation not on record	1
AUAlocation not on record	1

29 institutions · 247 of 248 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Prosartes smithii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 12.0–12.0

Seasonal swing summer↔winter7.20 °C

Max temp (day)13.9 °C

Min temp (night)10.8 °C

Precipitation93.2 mm/mo

Air humidity67.6 %

Vapour deficit454 Pa

Cloud cover36.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prosartes smithii

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 299 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 299 records