Prosartes lanuginosa

(Michx.) D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Prosartes

At a glance

Occurrence records2 286

Data sources11

Biological traits10

DNA specimens6

eDNA detections3

Sources11 archives

Databases and archives Prosartes lanuginosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 286 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF2 286 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Prosartes lanuginosa is a North American plant species in the lily family with the common names yellow mandarin or yellow fairybells.Flora of North America, Prosartes lanuginosaUnited States Department of Agriculture Plants Profile Prosartes lanuginosa is native to the Great Smoky Mountains and occurs in many other parts of the Appalachian region from New York to Alabama. Isolated populations occur outside Appalachia, as in the Ozarks of northern Arkansas and in southwestern Ontario.Horn, Cathcart, Hemmerly, Duhl, Wildflowers of Tennessee, the Ohio Valley, and the Southern Appalachians, Lone Pine Publishing, (2005) p 413,Biota of North America Program 2014 county distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prosartes lanuginosa has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG227550.1 ↗459 bpCanada · 1955

ACGT

AAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACAAAAGATACTGATATCTTGGCAGC …

Prosartes lanuginosa voucher CCDB-23955-C12 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Prosartes lanuginosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Utech, F. H. 1980. Chromosome atlas of the vascular plants of western Pennsylvania. I. Ann. Carnegie Mus. 49: 265–305.

CCDB · ipcn-api-dl — Tamura, M. N., F. H. Utech & S. Kawano. 1992. Biosystematic studies in Disporum (Liliaceae---Polygonateae) IV. Karyotype analysis of some Asiatic and North American taxa with special reference to their systematic status. Pl. Spec. Biol. 7: 103–120.

CCDB · eflora

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 286 records

Wild obs. + sensor1 965

Museum / vouchered317

Cultivated / captive4

Range

Area of Occupancy AOO5 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 900≤1 km 269≤10 km 123>10 km 265

1 557 georeferenced · 408 without coordinates

Open the mapobservation + sensor1 965

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 34≤1 km 54≤10 km 153>10 km 12

253 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence317

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	228
Chapel Hill, US	18
Morgantown, US	11
Bloomington, US	6
University of Tennessee at Chattanoogalocation not on record	5
Johnson City, US	5
Wuzhou, CN	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Université Lavallocation not on record	3
Auckland, NZ	3
Durham, US	2
Knoxville, US	2
Little Rock, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Tuscaloosa, US	1
Columbia, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Agriculture and Agri-Food Canadalocation not on record	1
Mississippi State, US	1
Saint Louis, US	1
Beijing, CN	1
Denver, US	1
Philadelphia, US	1
Tempe, US	1
Northridge, US	1
Davenport, US	1
Millersville, US	1
Asheville, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
AUAlocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
Richmond, US	1
Flagstaff, US	1
Boise, US	1
University of Alberta Museumslocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

36 institutions · 316 of 317 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Prosartes lanuginosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

in rich soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.6–21.6

Seasonal swing summer↔winter26.6 °C

Max temp (day)24.6 °C

Min temp (night)19.1 °C

Precipitation90.1 mm/mo

Air humidity59.9 %

Moisture balance-56.8 mm/mo

Vapour deficit1,030 Pa

Wind speed3.30 m/s

Cloud cover37.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prosartes lanuginosa

At a glance

Sources11 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 286 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 286 records