Proiphys cunninghamii

(Aiton ex Lindl.) Mabb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Proiphys

At a glance

Occurrence records223

Data sources7

Biological traits26

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Proiphys cunninghamii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility223 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF223 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Proiphys cunninghamii là một loài thực vật có hoa trong họ Amaryllidaceae. Loài này được Mabb. miêu tả khoa học đầu tiên năm 1980.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length16 mm

Fruit width16 mm

Leaf length62.5 mm

Leaf length max250 mm

Leaf length min80 mm

Leaf width46.5 mm

Leaf width max250 mm

Leaf width min100 mm

Petiole length17.5 cm

Life cycle & reproduction5

Flowering timennnnnnnnnnyy

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Proiphys cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU564853.1 ↗573 bpAustralia

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTATGAAACCCTAGATACTGATATCTTGGCAGC …

Proiphys cunninghamii ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type223 records

Wild obs. + sensor113

Museum / vouchered77

Cultivated / captive1

Other32

Origin

Native7

Range

Area of Occupancy AOO488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 60≤1 km 11≤10 km 3>10 km 6

80 georeferenced · 33 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 18≤1 km 4≤10 km 26>10 km 22

70 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence77

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	34
Museo Entomologico de Leonlocation not on record	15
Canberra, AU	9
Mount Annan, AU	7
Smithfield, AU	5
Armidale, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Adelaide, AU	1
Honolulu, US	1
Palmerston, AU	1

10 institutions · 76 of 77 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Proiphys cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 18.9–18.9

Seasonal swing summer↔winter11.7 °C

Max temp (day)24.4 °C

Min temp (night)14.0 °C

Precipitation55.9 mm/mo

Air humidity57.0 %

Moisture balance-51.7 mm/mo

Vapour deficit959 Pa

Wind speed1.70 m/s

Cloud cover23.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)