Proiphys amboinensis

(L.) Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Proiphys

At a glance

Occurrence records273

Data sources11

Biological traits28

DNA specimens6

eDNA detections5

Sources11 archives

Databases and archives Proiphys amboinensis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Proiphys amboinensis (syn. Eurycles amboinensis) was named after the island of Ambiona, now Ambon, in Indonesia. Common names include Cardwell lily and northern Christmas lily (as it usually flowers around Christmas). It is considered native to Thailand, Indonesia (Maluku, Sulawesi, Bali, Lombok, Timor), the Philippines, the Bismark Archipelago, Vanuatu, New Guinea, Queensland and Western Australia. Is also naturalized in Seychelles, Sri Lanka, Solomon Islands, Niue, Society Islands, Caroline Islands and Mariana Islands.Kew World Checklist of Selected Plant FamiliesFay, Michael F. and Mark W. Chase. 1996. Resurrection of Themidaceae for the Brodiaea alliance, and Recircumscription of Alliaceae, Amaryllidaceae and Agapanthoideae. Taxon 45 (3):441-451.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length27.5 mm

Fruit width22.5 mm

Leaf length250 mm

Leaf width250 mm

Petiole length37.5 cm

Plant height1 m

Plant height max0.3 m

Seed length11 mm

Life cycle & reproduction7

Deciduousnessdeciduous

Dispersal type detailedanthropochorous

Flowering timeyyyynnnnnnny

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapereniform widely_ovate

Succulenceno

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition13 compounds

Compounds documented for Proiphys amboinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Branched fatty acids $ Unsaturated fatty acids5

Unsaturated fatty acids4

Hydrocarbons3

Cinnamic acids and derivatives1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
9-Hexadecenoic acid	present	LOTUS
Behnic acid	present	LOTUS
Dodecanoic acid	present	LOTUS
Heptacosane	present	LOTUS
Heptadecanoic acid	present	LOTUS
Hexacosane	present	LOTUS
Methyleugenol	present	LOTUS
myristate	present	LOTUS
palmitate	present	LOTUS
Palmitelaidic acid	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Proiphys amboinensis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX645233.1 ↗632 bp

ACGT

CGAGGCCCGAACGGAAGATCGCGAACTCGTAGAGCACCCGTAGGGAGCGAGAAGGGGAGGCGATCGGCGCCTGCCTTTCTTGCCTCCTTG …

Proiphys amboinensis voucher NA:Meerow 3121 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Proiphys amboinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records10–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytological studies in the south Indian Eucharideae. New Bot. 17: 175–181.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

CCDB · ipcn-api-dl — Lakshmi, N. 1978a. Karyomorphological studies in an interchange heterozygote of Eurycles sylvestris Salisb. CIS Chromosome Inform. Serv. 25: 7–8.

CCDB · book-fedorov — Mookerjea 1955a

2n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ponnamma, M. G. & C. A. Ninan. 1978b. Cytological studies on Eurycles sylvestris Salisb. New Bot. 5: 79–83.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.932 ↗

08Occurrence & distribution

Record type273 records

Wild obs. + sensor63

Museum / vouchered181

Cultivated / captive2

Other27

Origin

Native4

Introduced1

Range

Area of Occupancy AOO644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 14≤1 km 15≤10 km 8>10 km 12

49 georeferenced · 14 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 26≤1 km 14≤10 km 49>10 km 14

103 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence181

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	42
Smithfield, AU	42
Museo Entomologico de Leonlocation not on record	14
Canberra, AU	12
Kew, GB	8
Mount Annan, AU	5
James Cook Townsvillelocation not on record	3
Xiamen, CN	3
Auckland, NZ	3
Paris, FR	2
Bronx, US	1
Kensington, AU	1
University of Stellenboschlocation not on record	1
Armidale, AU	1
University of the Sunshine Coastlocation not on record	1
Gump Stationlocation not on record	1
Palmerston, AU	1

17 institutions · 141 of 181 vouchered records shown · 40 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Proiphys amboinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 22.1–22.1

Seasonal swing summer↔winter5.20 °C

Max temp (day)23.4 °C

Min temp (night)20.5 °C

Precipitation294 mm/mo

Air humidity72.0 %

Moisture balance152 mm/mo

Vapour deficit738 Pa

Wind speed8.70 m/s

Cloud cover57.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)