Prodiamesa olivacea

(Meigen, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Chironomidae/Prodiamesa

At a glance

Occurrence records8 857

Data sources8

Biological traits0

DNA specimens207

eDNA detections277

Sources8 archives

Databases and archives Prodiamesa olivacea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 857 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI277 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics207 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.13 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 857 records

Environmental DNA3 datasets · 16 countries277 detections

DNA & barcodingBOLD207 specimens

Genome at a glanceGoaT127 Mbp

01Narrative

Prodiamesa olivacea is a species of fly in the family Chironomidae. It is found in the Palearctic.Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding207 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prodiamesa olivacea has left across the world's sequence archives.

At a glance

DNA specimens207

BINs1

Marker genes2

eDNA detections277

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus194 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

45Tmostly conserved

168Avariable

195Gmostly conserved

204Tmostly conserved

219Cvariable

228Gmostly conserved

234Cmostly conserved

315Gvariable

342Cmostly conserved

366Cmostly conserved

372Gmostly conserved

474Tvariable

498Gmostly conserved

507Amostly conserved

564Tmostly conserved

582Tmostly conserved

633Cmostly conserved

639Tmostly conserved

651Tmostly conserved

ACTTTATATTTCATTTTTGGAGCCTGATCAGGAATAGTAGGTACTTCCCTTAGTATCTTAATTCGTGCAGAATTAGGTCATCCCGGTGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes38

BIN1

Most divergent pair3.0%

EuropeOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hydrobaenus dentistylussame family11.9%Paratrissocladius excerptussame family12.0%Chaetocladius holmgrenisame family12.1%Diamesa bertramisame family12.5%Polypedilum cultellatumsame family12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_060344 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Prodiamesa olivacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size127 140 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Prodiamesa olivacea0.13 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type8 857 records

Wild obs. + sensor8 164

Museum / vouchered693

Range

Area of Occupancy AOO13 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 5 517≤1 km 88≤10 km 405>10 km 1

6 011 georeferenced · 2 153 without coordinates

Open the mapobservation + sensor8 164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 354≤1 km 14≤10 km 12

380 georeferenced · 313 without coordinates

Open the institutions mapphysical evidence693

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	98
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Champaign, US	10
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
Rovaniemi, FI	5
SLU Artdatabankenlocation not on record	4
CBDClocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
Tromsø, NO	1
Toronto, CA	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
NCMGlocation not on record	1

13 institutions · 148 of 693 vouchered records shown · 544 without an institution code

09Environmental DNA277 detections

Where the DNA of Prodiamesa olivacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found277

Studies independent surveys3

Countries16

Verifiable raw sequence linked83

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 277 detections have coordinates

Open the map16 countries0

Farmenvironment, farmland, coast and birch h…river2nd order headwater stream draining in agric…UrbanForest edge (suburban)water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 6.20–19.2

Seasonal swing summer↔winter19.9 °C

Max temp (day)14.9 °C 9.60–22.5

Min temp (night)8.00 °C 2.30–13.6

Precipitation93.0 mm/mo 56.0–148

Air humidity60.4 % 56.0–65.2

Moisture balance-0.1 mm/mo -51.2–79.4

Vapour deficit538 Pa 382–951

Wind speed3.40 m/s 1.70–5.50

Cloud cover49.2 % 33.1–62.0

CHELSA 1981–2010, ~9 km grid, at location & month of 268 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prodiamesa olivacea

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type8 857 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 857 records