Prockia crucis
P.Browne ex L. · speciesAt a glance
Occurrence records2 669
Data sources10
Biological traits24
DNA specimens3
eDNA detections5
Sources10 archives
Databases and archives Prockia crucis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 669 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources24 traits
Occurrence & distributionGBIF2 669 records
Environmental DNA1 datasets · 1 countries5 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Prockia crucis là một loài thực vật có hoa trong họ Liễu. Loài này được L. miêu tả khoa học đầu tiên năm 1762.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology7
Leaf size3 000 mm²
Plant height4 m
⚠ sources differ — GIFT: 4 m · TRY: 10 m
Plant height max10 m
Seed mass0.404 mg
Seed volume4.2 mm³
Seed volume max4.2 mm³
Seed volume min4.2 mm³
Life cycle & reproduction4
Deciduousnessevergreen
Life formshrub or tree
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 500 m
Elevation min0 m
Epiphyteterrestrial
Growth formtree
⚠ sources differ — GIFT: tree · TRY: Shrub
Habitat GIFTBosque alto
Woodinesswoody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Wood density616 mg/cm³
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prockia crucis has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes2
GenBank sequences8
eDNA detections5
Countries2
The DNA barcodea real sequence read deposited for this species
CGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCA …
Prockia crucis voucher BioBot01626 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Prockia crucis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–182n range18median18mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 182×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Morawetz, W. 1981
CCDB · ipcn-api-dl — Morawetz, W. 1981b. Zur systematischen Stellung der Gattung Prockia: Karyologie und Epidermisskulptur im Vergleich zu Flacourtia (Flacourtiaceae), Grewia (Tiliaceae) und verwandten Gattunge. xx. Pl. Syst. Evol. 139: 57–76.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 669 records
Wild obs. + sensor63
Museum / vouchered2 568
Other38
Origin
Native550
Range
Area of Occupancy AOO5 028 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy60% within 1 km
≤100 m 16≤1 km 9≤10 km 7>10 km 10
42 georeferenced · 21 without coordinates
Open the mapobservation + sensor63
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy83% within 1 km
≤100 m 222≤1 km 13≤10 km 38>10 km 11
284 georeferenced · 2 284 without coordinates
Open the institutions mapphysical evidence2 568
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions72 of 179 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 410 |
| Bronx, US | 145 |
| Durango, MX | 134 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 118 |
| National Biodiversity Institute, Costa Ricalocation not on record | 77 |
| Istituto Agrario Castelnuovolocation not on record | 71 |
| Antiguo Cuscatlán, SV | 69 |
| Mexico City, MX | 67 |
| Chicago, US | 66 |
| Berlin, DE | 51 |
| Blumenau, BR | 48 |
| University of Stellenboschlocation not on record | 44 |
| UFMSlocation not on record | 44 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 41 |
| Kew, GB | 39 |
| JBRJlocation not on record | 38 |
| UTFPR-CPlocation not on record | 38 |
| Santa Cruz de la Sierra, BO | 35 |
| UNIVASFlocation not on record | 31 |
| Campo Mourão, BR | 31 |
| Austin, US | 31 |
| Laboratorio de Ictiologialocation not on record | 31 |
| Ivano-Frankivsk, UA | 30 |
| Chaguaramas, TT | 29 |
| South Kensington, GB | 28 |
| UNICAMPlocation not on record | 24 |
| León, NI | 18 |
| Departamento de Sistematica e Ecologialocation not on record | 18 |
| Masindi, UG | 17 |
| Feira de Santana, BR | 17 |
| Universidad Nacional de Asunciónlocation not on record | 17 |
| Salvador, BR | 16 |
| Tuxtla Gutiérrez, MX | 15 |
| USP-IBlocation not on record | 14 |
| UNESP-IBILCElocation not on record | 13 |
| La Paz, BO | 13 |
| Universiti Sains Malaysialocation not on record | 12 |
| MAlocation not on record | 12 |
| UFBAlocation not on record | 12 |
| Cascavel, BR | 12 |
| Austin, US | 12 |
| San Isidro, AR | 11 |
| Tampa, US | 11 |
| Autlán de Navarro, MX | 11 |
| UEMlocation not on record | 11 |
| Loja, EC | 11 |
| Londrina, BR | 10 |
| Paleontological Collectionlocation not on record | 10 |
| HUT Culture Collectionlocation not on record | 10 |
| Corrientes, AR | 10 |
| San José, CR | 10 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 9 |
| University of Southern Mississippilocation not on record | 9 |
| Jena Microbial Resource Collectionlocation not on record | 9 |
| UnBlocation not on record | 9 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 9 |
| CJBGlocation not on record | 8 |
| Riverside, US | 8 |
| Brasília, BR | 8 |
| Universidade Federal de Sergipe (UFS)location not on record | 8 |
| Chapingo, MX | 7 |
| San Francisco, US | 7 |
| Brasília, BR | 7 |
| Maringá, BR | 7 |
| Sucre, BO | 7 |
| Giardini Botanici Hanburylocation not on record | 7 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 7 |
| Cenargenlocation not on record | 7 |
| UTFPR-DVlocation not on record | 6 |
| INMAlocation not on record | 6 |
| Moscow State Universitylocation not on record | 6 |
| Santa Teresa, BR | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| UFMGlocation not on record | 6 |
| UNESP-RClocation not on record | 6 |
| Cochabamba, BO | 6 |
| Lima, PE | 6 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 6 |
| CEPLAClocation not on record | 6 |
| ASUlocation not on record | 6 |
| UNESP, Campus São José Rio Prêtolocation not on record | 6 |
| San Francisco de Campeche, MX | 6 |
| Tuxtla Gutiérrez, MX | 5 |
| IPA/SPlocation not on record | 5 |
| Castelar, AR | 5 |
| UNESClocation not on record | 5 |
| UNESP-ISlocation not on record | 5 |
| Fort Worth, US | 5 |
| Chongqing Museumlocation not on record | 5 |
| Tapachula, MX | 5 |
| UTFPR-SLlocation not on record | 5 |
| Criciúma, BR | 5 |
| UNIVILLElocation not on record | 5 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 5 |
| Museo de Historia Natural de El Salvadorlocation not on record | 5 |
| Iquitos, PE | 5 |
| UFSClocation not on record | 4 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| Edinburgh, GB | 4 |
| NO DISPONIBLElocation not on record | 4 |
| Cusco, PE | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| UFPElocation not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Montréal, CA | 3 |
| MEXUlocation not on record | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| Foz do Iguaçu, BR | 3 |
| UFPRlocation not on record | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| BMlocation not on record | 3 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| Fortaleza, BR | 2 |
| Stockholm, SE | 2 |
| Université de Bordeauxlocation not on record | 2 |
| UFRPElocation not on record | 2 |
| UNESP-FCAVlocation not on record | 2 |
| Ural Federal University "B. N. Yeltsin"location not on record | 2 |
| Ilhéus, BR | 2 |
| Cambridge, US | 2 |
| EL PASO, US | 2 |
| Uppsala, SE | 2 |
| Paris, FR | 2 |
| Davis, US | 2 |
| UTPLlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Wuzhou, CN | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Phoenix, US | 2 |
| Flagstaff, US | 2 |
| Göteborg, SE | 2 |
| Guatemala City, GT | 1 |
| INBIOlocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Elocation not on record | 1 |
| UEGlocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| MUFALlocation not on record | 1 |
| Aarhus, DK | 1 |
| Mérida, MX | 1 |
| Managua, NI | 1 |
| UNEMATlocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Toluca, MX | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| UFAClocation not on record | 1 |
| URCAlocation not on record | 1 |
| VALElocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Glocation not on record | 1 |
| UFSJlocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| UNESP-FCAlocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| LDlocation not on record | 1 |
| Córdoba, AR | 1 |
| Universidade Paulistalocation not on record | 1 |
| UNICENTRO-IRATIlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| JBPlocation not on record | 1 |
| Instituto do Meio Ambientelocation not on record | 1 |
| UESBlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Beijing, CN | 1 |
179 institutions · 2 523 of 2 568 vouchered records shown · 45 without an institution code
09Environmental DNA5 detections
Where the DNA of Prockia crucis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.9 °C 24.9–24.9
Seasonal swing summer↔winter2.00 °C
Max temp (day)26.6 °C
Min temp (night)23.4 °C
Precipitation114 mm/mo
Air humidity68.0 %
Moisture balance-20.2 mm/mo
Vapour deficit1,003 Pa
Wind speed4.00 m/s
Cloud cover30.9 %
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.