Procambarus paeninsulanus

(Faxon, 1914) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Cambaridae/Procambarus

At a glance

Occurrence records411

Data sources5

Biological traits0

DNA specimens190

eDNA detections193

Sources5 archives

Databases and archives Procambarus paeninsulanus's data was compiled from.

GBIFGlobal Biodiversity Information Facility411 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI193 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics190 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF411 records

Environmental DNA1 datasets · 0 countries193 detections

DNA & barcodingBOLD190 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding190 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Procambarus paeninsulanus has left across the world's sequence archives.

At a glance

DNA specimens190

BINs5

Marker genes1

eDNA detections193

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus190 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

23Tvariable

35Amostly conserved

74Gvariable

77Gvariable

80Gvariable

83Amostly conserved

89Gmostly conserved

104Tmostly conserved

122Gmostly conserved

134Cvariable

191Amostly conserved

194Tmostly conserved

200Amostly conserved

203Tmostly conserved

221Cvariable

224Avariable

263Gvariable

272Tvariable

317Amostly conserved

320Tvariable

332Gvariable

341Tmostly conserved

350Amostly conserved

371Amostly conserved

392Tmostly conserved

419Gmostly conserved

422Cvariable

458Tvariable

470Gvariable

476Gvariable

501Tvariable

515Amostly conserved

557Avariable

578Gmostly conserved

593Tmostly conserved

620Gmostly conserved

626Tvariable

632Avariable

635Tmostly conserved

647Cmostly conserved

GAACATTATATTTTGTTTTTGGTACTTGAGCTGGAATAGTAGGAACTTCATTAAGAATGATTATTCGAGTAGAGTTGGGGCAACCAGGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 46 variants.

Diversity (π)2.3%

Haplotypes46

BINs5

Most divergent pair4.4%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Procambarus troglodytessame genus5.4%Procambarus rogersisame genus6.6%Procambarus clarkiisame genus6.7%Procambarus spiculifersame genus7.4%Procambarus lunzisame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type411 records

Wild obs. + sensor10

Museum / vouchered401

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 4>10 km 4

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 400 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	372
Champaign, US	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
University of Central Floridalocation not on record	3
Montgomery, US	2
Cambridge, US	1
Chicago, US	1

7 institutions · 401 of 401 vouchered records shown

09Environmental DNA193 detections

Where the DNA of Procambarus paeninsulanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found193

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 193 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)