Pritchardia lowreyana — The Life Data

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Pritchardia

At a glance

Occurrence records2

Data sources9

Biological traits28

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Pritchardia lowreyana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Pritchardia lowreyana, the Molokai pritchardia, is a species of fan palm that is endemic to Hawaii in the United States. It is found in mixed mesic and wet forests on the island of Molokai. P. lowreyana reaches a height of 2 -, and normally grows in gulches and on cliffs. It was named in 1918 for Cherilla Storrs Lowrey (1861–1918), an American clubwoman active in tree-planting and beautification projects around Honolulu.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length47.5 mm

Fruit length max60 mm

Fruit length min35 mm

Fruit width37.5 mm

Fruit width max45 mm

Fruit width min30 mm

Leaf length max1 700 mm

Leaf length min800 mm

Plant height10 m

Plant height max4 m

Plant height min2 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourblack

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits5

Dbh max100 cm

Defenseno

Leaf spinesno

Shoot length max1 000 cm

Shoot orientationerect

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pritchardia lowreyana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

matKJF905396.1 ↗1 691 bp

ACGT

AAGAATTACAAGGATATTTAGAAAGAGATAGATCTCTGCAACAACACTTTCTATATCCGCTTCTCTTTAAGGAGTATATTTACACATTTC …

Pritchardia lowreyana voucher K. Wood 9236 (PTBG) tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2

plant barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	1
Dresden, DE	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Pritchardia lowreyana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.