Pristis pectinata

Latham, 1794 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Rhinopristiformes/Pristidae/Pristis

At a glance

Occurrence records1 990

Data sources13

Biological traits10

DNA specimens55

eDNA detections45

Sources13 archives

Databases and archives Pristis pectinata's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 104 records↗

OBISOcean Biodiversity Information System886 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources10 traits

Occurrence & distributionGBIF · OBIS1 990 records

Environmental DNA1 datasets · 0 countries45 detections

DNA & barcodingBOLD55 specimens

Genome at a glanceGoaT · NCBI2.7 Gbp

01Narrative

The smalltooth sawfish (Pristis pectinata) is a species of sawfish in the family Pristidae. It is found in shallow tropical and subtropical waters in coastal and estuarine parts of the Atlantic. Reports from elsewhere are now believed to be misidentifications of other species of sawfish. It is a critically endangered species that has disappeared from much of its historical range.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length760 cm

Body mass350 000 g

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max88 m

Depth min10 m

Vulnerability84.4

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pristis pectinata has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes11

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

CTTGTATTTAGTTTTTGGTGCTTGAGCAGGAATGGTTGGTACTGGTCTAAGTTTACTTATTCGAACAGAACTTAGCCAACCAGGAACACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pristis zijsronsame genus8.7%Pristis clavatasame genus10.9%Pristis perottetisame genus12.4%Pristis pristissame genus12.7%Rhina ancylostomasame order13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027182 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pristis pectinata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 738 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pristis pectinata2.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness92.8% BUSCO

08Occurrence & distribution

Record type1 990 records

Wild obs. + sensor1 755

Museum / vouchered231

Other4

Origin

Native10

Range

Area of Occupancy AOO1 616 km²

Depth

0–200 m sunlit23

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 30 m · max 152.5 m · 23 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 4≤10 km 67>10 km 86

157 georeferenced · 1 598 without coordinates

Open the mapobservation + sensor1 755

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 26≤1 km 4≤10 km 25>10 km 32

87 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Texas Biodiversity Collections (UTBC)location not on record	27
Paris, FR	22
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	14
Cambridge, US	8
Chicago, US	6
	6
FishBaselocation not on record	6
Ohio State University - Fish Division, Columbus, OH (OSUM)location not on record	5
Texas Cooperative Wildlife Collectionlocation not on record	5
Royal Museum for Central Africalocation not on record	3
New Haven, US	3
Washington, US	3
Los Angeles, US	3
CASlocation not on record	2
North Carolina Museum of Natural Scienceslocation not on record	2
Stockholm, SE	2
SEAOBISlocation not on record	1
Vancouver, CA	1
National Natural History Collectionslocation not on record	1
Auckland, NZ	1
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Barcelona, ES	1
Mexico City, MX	1
University of Alabamalocation not on record	1
Ann Arbor, US	1

25 institutions · 126 of 231 vouchered records shown · 2 without an institution code

09Environmental DNA45 detections

Where the DNA of Pristis pectinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pristis pectinata

At a glance

Sources13 archives

Size & morphology2

Habitat & environment4

Uses & economy1

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 990 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 990 records