Pristiophorus nudipinnis

Günther, 1870 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Pristiophoriformes/Pristiophoridae/Pristiophorus

At a glance

Occurrence records4 141

Data sources10

Biological traits7

DNA specimens22

eDNA detections19

Sources10 archives

Databases and archives Pristiophorus nudipinnis's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 930 records↗

OBISOcean Biodiversity Information System2 211 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS4 141 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD22 specimens

01Narrative

The shortnose sawshark, (Pristiophorus nudipinnis) or southern sawshark, is a sawshark of the family Pristiophoridae. The body of this shark is slightly compressed, and its rostrum is narrow. The two dorsal fins are almost identical in size. In color, the dorsal side of this sawshark tends to be uniformly slate gray, with few or no markings. The ventral side is pale white or cream. Females reach around 124 cm long, and males reach around 110 cm long. These sharks can live up to 9 years.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length122 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max165 m

Depth min37 m

Vulnerability73.2

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pristiophorus nudipinnis has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

178Tmostly conserved

625Amostly conserved

634Cmostly conserved

649Tmostly conserved

CCTATATTTAATTTTTGGTGCATGAGCAGGGATAGTTGGCACTGCCCTAAGCCTACTTATCCGAGCAGAGCTCGGTCAGCCTGGGACACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes3

BIN1

Most divergent pair10.0%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Odontaspis noronhaisame order17.2%Squatina guggenheimsame order17.3%Chiloscyllium arabicumsame order17.5%Prionace glaucasame order17.5%Carcharhinus brachyurussame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 141 records

Wild obs. + sensor3 771

Museum / vouchered370

Origin

Native6

Range

Area of Occupancy AOO5 400 km²

Depth

0–200 m sunlit1 767

200–1000 m twilight24

1–4 km midnight0

>4 km abyssal0

median 74.2 m · max 450 m · 1 791 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 12≤1 km 3 289≤10 km 221>10 km 236

3 758 georeferenced · 13 without coordinates

Open the mapobservation + sensor3 771

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 28≤1 km 90≤10 km 46>10 km 8

172 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence370

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	44
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	29
Museums Victorialocation not on record	27
Tasmanian Museum & Art Gallerylocation not on record	8
QVMAGlocation not on record	8
Sydney, AU	7
CSIRO, Australian National Fish Collectionlocation not on record	3
Western Australian Museumlocation not on record	2
Cambridge, US	1
Paris, FR	1
Natick, US	1
Zoologisches Museum Hamburglocation not on record	1
	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

15 institutions · 135 of 370 vouchered records shown · 23 without an institution code

09Environmental DNA19 detections

Where the DNA of Pristiophorus nudipinnis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 12.0–16.3

Seasonal swing summer↔winter7.00 °C

Max temp (day)17.2 °C 13.6–18.3

Min temp (night)13.0 °C 10.2–14.7

Precipitation59.6 mm/mo 28.9–76.4

Air humidity58.0 % 54.8–59.7

Vapour deficit720 Pa 573–813

Cloud cover22.9 % 16.2–35.9

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pristiophorus nudipinnis

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type4 141 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 141 records