Prismatomeris sessiliflora

Pierre ex Pit. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Prismatomeris

At a glance

Occurrence records17

Data sources6

Biological traits12

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Prismatomeris sessiliflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Chemical compositionLOTUS · NPASS64 compounds

Occurrence & distributionGBIF17 records

DNA & barcodingNCBIsequences

01Narrative

Prismatomeris sessiliflora là một loài thực vật có hoa trong họ Thiến thảo. Loài này được Pierre ex Pit. miêu tả khoa học đầu tiên năm 1924.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology3

Seed volume90 mm³

Seed volume max90 mm³

Seed volume min90 mm³

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Woodinesswoody

03Chemical composition64 compounds

Compounds documented for Prismatomeris sessiliflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aspidosperma type34

Corynanthe type13

Anthraquinones and anthrones2

Corynanthe type $ Strychnos type1

Corynanthe type $ Yohimbine-like alkaloids1

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(12R,19R)-12-ethyl-8,16-diazatetracyclo[10.6.1.02,7.016,19]nonadeca-1(18),2,4,6-tetraen-9-one	present	NPASS
(12S,19R)-12-ethyl-19-hydroxy-8,16-diazatetracyclo[10.6.1.02,7.016,19]nonadeca-1(18),2,4,6-tetraene-9,17-dione	present	NPASS
(1S,12R,13R,16S,23S)-12-hydroxy-11,12-bis(methoxycarbonyl)-6,8-dioxa-11,20-diazahexacyclo[14.6.1.01,13.02,10.05,9.020,23]tricosa-2(10),3,5(9),17-tetraene-16-carboxylic acid	present	NPASS
(1S,9R,10R,13S,20S)-9-hydroxy-6-methoxy-8,9-bis(methoxycarbonyl)-8,17-diazapentacyclo[11.6.1.01,10.02,7.017,20]icosa-2(7),3,5,14-tetraene-13-carboxylic acid	present	NPASS
(1S,9R,15S,16S,17S,18R,21R)-15,17,18-trihydroxy-18-methoxycarbonyl-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3,5,7-triene-2-carboxylic acid	present	NPASS
(5R,17S)-5-ethyl-17-hydroxy-1,9-diazatetracyclo[8.6.1.05,17.011,16]heptadeca-9,11,13,15-tetraen-2-one	present	NPASS
16-Epikopsinine	present	NPASS
6,7-Dehydroleuconoxine	present	NPASS
AGZHUPIPORRGEL-GPSZQEKBSA-N	present	NPASS
Akuammidine	present	NPASS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prismatomeris sessiliflora has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAB925714.1 ↗531 bpCambodia · 2011

ACGT

GTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCCCAACCC …

Prismatomeris sessiliflora chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, specimen_voucher: KYUM<JPN>:893

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

08Occurrence & distribution

Record type17 records

Museum / vouchered17

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence17

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima, JP	3
National Institute of Biological Resourceslocation not on record	1
Xiamen, CN	1
Moscow State Universitylocation not on record	1
Kew, GB	1

5 institutions · 7 of 17 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)