Primula glutinosa

Wulfen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Primulaceae/Primula

At a glance

Occurrence records3 168

Data sources9

Biological traits26

DNA specimens9

eDNA detections5

Sources9 archives

Databases and archives Primula glutinosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF3 168 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 66

01Narrative

La Primevère glutineuse est une espèce de plantes à fleurs de la famille des Primulacées.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology7

Leaf size118 mm²

Plant height0.045 m

Plant height generative0.055 m

Plant height max0.08 m

Plant height min0.03 m

Seed length1.3 mm

Seed mass0.223 mg

Life cycle & reproduction7

DeciduousnessN

Dispersal typeself

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf c470 mg/g

Leaf dry-matter content (LDMC)211 mg/g

Leaf n27.07 mg/g

Leaf p2.44 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)13.29 mm²/mg

Other traits1

Diaspore typeseed

03Chemical composition1 compounds

Compounds documented for Primula glutinosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Benzoquinones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Primin		present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Primula glutinosa has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences5

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF260755.1 ↗617 bp

ACGT

CGAAACCTGCACAGCAGAACGACCCGCGAACTTGTATCTAAACCAGGGAGACACTGGATGGGCCATCGGCCTATTTGGTGTTTTCCTCTC …

Primula glutinosa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★trnL★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Primula glutinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 66 n = 33

Ploidypolyploid inferred

Chromosome records66–662n range66median66mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 662×CCDB · fl-europaea · CCDB · ipcn-api-dl

CCDB · fl-europaea — Kress, 1963

CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.

2n 672×CCDB · fl-europaea · CCDB · Cave1963

CCDB · fl-europaea — Kress, 1963

CCDB · Cave1963 — Kiress 1963

n 331×CCDB · Cave1963

CCDB · Cave1963 — Kiress 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 168 records

Wild obs. + sensor2 683

Museum / vouchered423

Cultivated / captive1

Other61

Range

Area of Occupancy AOO2 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 687≤1 km 255≤10 km 1 574>10 km 9

2 525 georeferenced · 158 without coordinates

Open the mapobservation + sensor2 683

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 13≤1 km 146≤10 km 144>10 km 9

312 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence423

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GJOlocation not on record	116
Salzburg, AT	104
Zürich, CH	58
Zürich, CH	37
Oskarshamn, SE	20
LDlocation not on record	18
Adam Mickiewicz University in Poznańlocation not on record	17
Wlocation not on record	7
Provincia di Livornolocation not on record	7
inatura Erlebnis Naturschau GmbHlocation not on record	6
SZUlocation not on record	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
Wellington, NZ	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Berlin, DE	2
Frankfurt am Main	2
Bern, CH	2
Dresden, DE	1
MAlocation not on record	1
University of Salzburglocation not on record	1
Görlitz, DE	1
BRNUlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Moscow State Universitylocation not on record	1
GZUlocation not on record	1
BIO-UNIPIlocation not on record	1
Universität Göttingenlocation not on record	1
SNSNMClocation not on record	1
Karlsruhe, DE	1

29 institutions · 423 of 423 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Primula glutinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

alpine pastures and rocky habitats on silice…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.10 °C 6.10–6.10

Seasonal swing summer↔winter19.4 °C

Max temp (day)10.8 °C

Min temp (night)0.2 °C

Precipitation271 mm/mo

Air humidity63.6 %

Moisture balance160 mm/mo

Vapour deficit346 Pa

Wind speed6.20 m/s

Cloud cover37.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Primula glutinosa

At a glance

Sources9 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment4

Physiology & chemistry6

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 168 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 168 records