Prasophyllum frenchii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Prasophyllum

At a glance

Occurrence records248

Data sources5

Biological traits26

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Prasophyllum frenchii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility248 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF248 records

DNA & barcodingNCBIsequences

01Narrative

Prasophyllum frenchii, commonly known as the maroon leek orchid or swamp leek orchid, is a species of orchid endemic to south-eastern continental Australia. It has a single tubular green leaf and up to sixty five green, reddish-brown or red flowers. Formerly more widespread, it is now confined to seven populations containing a total of fewer than 1,000 plants.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length200 mm

Leaf width6.5 mm

Plant height0.55 m

Plant height max0.6 m

Plant height min0.15 m

Seed mass0.001 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnnnnyyn

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf shapeterete

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prasophyllum frenchii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKF929483.1 ↗684 bp

ACGT

ATCATTGTCGAGACCGAATTGAGACCGAGCCATTCTGAAAACCTGTGATCTATCACTCTGGCGCCGGCGAATGTCGTCGCCAGGCACCGG …

Prasophyllum frenchii isolate D311 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type248 records

Wild obs. + sensor62

Museum / vouchered185

Cultivated / captive1

Origin

Native67

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤1 km 4≤10 km 50>10 km 8

62 georeferenced

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤1 km 156≤10 km 28

184 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence185

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	88
Adelaide, AU	43
Canberra, AU	33
Mount Annan, AU	16
Hobart, AU	2
Smithfield, AU	1
QVMAGlocation not on record	1

7 institutions · 184 of 185 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)