Prasophyllum flavum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Prasophyllum

At a glance

Occurrence records551

Data sources5

Biological traits28

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Prasophyllum flavum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility551 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF551 records

DNA & barcodingNCBIsequences

01Narrative

Prasophyllum flavum, commonly known as the yellow leek orchid, is a species of orchid endemic to eastern Australia. It has a single tubular, green leaf with only a short free section and up to fifty scented, yellowish-green flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Leaf length30 mm

Leaf width5 mm

Plant height0.9 m

Plant height max0.9 m

Life cycle & reproduction10

Dispersal typewind

Flowering endJan

Flowering startOct

Flowering timeynnnnnnnnyyy

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prasophyllum flavum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKF929482.1 ↗700 bp

ACGT

ATCATTGTCGAGATCGAAAAGAGTCGGAGCAATTCTTGAAACCCATGAACTACTACCGGGGTATAGGTGCTCGCTGTCCCAGGACACCCA …

Prasophyllum flavum isolate s0642 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type551 records

Wild obs. + sensor361

Museum / vouchered186

Cultivated / captive4

Origin

Native31

Introduced1

Range

Area of Occupancy AOO1 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 120≤1 km 61≤10 km 62>10 km 77

320 georeferenced · 41 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 8≤1 km 22≤10 km 109>10 km 19

158 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence186

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 3

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	53
Museo Entomologico de Leonlocation not on record	50
Mount Annan, AU	31
Hobart, AU	10
Adelaide, AU	10
Brisbane, AU	7
Smithfield, AU	7
Armidale, AU	6
QVMAGlocation not on record	6
Wollongong, AU	3
Batemans Bay, AU	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1

12 institutions · 186 of 186 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)