Prasophyllum colensoi

Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Prasophyllum

At a glance

Occurrence records1 760

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Prasophyllum colensoi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 760 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF1 760 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 42

01Narrative

Prasophyllum colensoi is a species of orchid endemic to New Zealand where it is commonly known as the leek orchid. It has a single tubular, dark green leaf and up to twenty scented, yellowish-green to reddish-brown flowers. It is similar to P. hectori, the only other species of Prasophyllum found in New Zealand, but is distinguished from it by its smaller size, fewer flowers and different habitat.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Leaf length max250 mm

Plant height0.17 m

⚠ sources differ — GIFT: 0.17 m · TRY: 0.2 m

Plant height max0.25 m

Life cycle & reproduction8

Deciduousnessdeciduous

Dispersal typewind

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prasophyllum colensoi has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF929476.1 ↗684 bp

ACGT

ATCATTGTCGAGACCGAATTGAGACCGAGCCATTCTGAAAACCTGTGATCTATCACTCTGGCGCCGGCGAATGTCGTCGCCAGGCACCGG …

Prasophyllum colensoi isolate s1258 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Prasophyllum colensoi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · new-zealand

CCDB · new-zealand

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 760 records

Wild obs. + sensor1 288

Museum / vouchered472

Range

Area of Occupancy AOO4 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 662≤1 km 199≤10 km 72>10 km 63

996 georeferenced · 292 without coordinates

Open the mapobservation + sensor1 288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 3≤10 km 6>10 km 2

12 georeferenced · 460 without coordinates

Open the institutions mapphysical evidence472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	254
Wellington, NZ	132
Auckland, NZ	64
Rotorua, NZ	14
Museo Entomologico de Leonlocation not on record	3
Chicago, US	2
Tampa, US	1
Smithfield, AU	1
Canberra, AU	1

9 institutions · 472 of 472 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prasophyllum colensoi

At a glance

Sources7 archives

Size & morphology3

Life cycle & reproduction8

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 760 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 9 geolocated

Record type1 760 records