Prasophyllum brownii

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Prasophyllum

At a glance

Occurrence records149

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Prasophyllum brownii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF149 records

DNA & barcodingNCBIsequences

01Narrative

Prasophyllum brownii, commonly known as the Christmas leek orchid, is a species of orchid endemic to the south-west of Western Australia. It is one of the last of the genus in Western Australia to flower and has a tall flowering stem with up to eighty pale green and fawn-coloured flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length600 mm

Leaf width8.5 mm

Plant height1.2 m

Plant height max1.2 m

Plant height min0.4 m

Seed mass0.005 mg

Life cycle & reproduction6

Flowering timeynnnnnnnnnyy

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prasophyllum brownii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKF929472.1 ↗700 bp

ACGT

ATCATTGGCTTGACCGAAAAGAGACCGAGCAATTCTAAAAGCCCATGAACTACTACTGGGGCAAGGGCGCTCGCCGTCCCCAGACACCCG …

Prasophyllum brownii isolate s0824 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor92

Museum / vouchered55

Cultivated / captive2

Origin

Native2

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 43≤1 km 11≤10 km 4>10 km 10

68 georeferenced · 24 without coordinates

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 14≤1 km 4≤10 km 25>10 km 2

45 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence55

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	27
Canberra, AU	18
Adelaide, AU	5
Mount Annan, AU	2
Museo Entomologico de Leonlocation not on record	2
BGPAlocation not on record	1

6 institutions · 55 of 55 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)