Prasiola stipitata

Suhr ex Jess. · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Trebouxiophyceae/Prasiolales/Prasiolaceae/Prasiola

At a glance

Occurrence records2 047

Data sources9

Biological traits0

DNA specimens23

eDNA detections13

Sources9 archives

Databases and archives Prasiola stipitata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 438 records↗

OBISOcean Biodiversity Information System609 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS2 047 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceGoaT220 Mbp

01Narrative

Prasiola stipitata is a small green alga.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Prasiola stipitata has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes4

GenBank sequences10

eDNA detections13

Countries4

The DNA barcodea real sequence read deposited for this species

rbcLHQ603385.1 ↗490 bpCanada · 2006

ACGT

TTACTACACTCCAGATTATCAAGTAAAAGAAACGATATTCTTGCAGCTTTTCGTATGACTCCTCAATCAGGGGTTCCAGCTGAAGAATGT …

Prasiola stipitata voucher GWS003898 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL10★rbcLatufAUPA

plant barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Prasiola stipitata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size220 050 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Prasiola stipitata0.22 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

08Occurrence & distribution

Record type2 047 records

Wild obs. + sensor607

Museum / vouchered1 150

Other290

Range

Area of Occupancy AOO3 704 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 7 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 406≤1 km 50≤10 km 109>10 km 3

568 georeferenced · 39 without coordinates

Open the mapobservation + sensor607

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 18≤1 km 422≤10 km 52>10 km 34

526 georeferenced · 624 without coordinates

Open the institutions mapphysical evidence1 150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Clocation not on record	291
Durham, US	133
South Kensington, GB	58
LDlocation not on record	43
Alfred-Wegener-Institut für Polar- und Meeresforschunglocation not on record	25
Uppsala, SE	25
Bronx, US	17
Wellington, NZ	16
Acadia Universitylocation not on record	11
TROMlocation not on record	7
Vancouver, CA	7
University of New Brunswick, Frederictonlocation not on record	6
Trondheim, NO	5
Adelaide, AU	5
University of Stellenboschlocation not on record	5
Tampa, US	5
DASSHlocation not on record	5
PNHSlocation not on record	4
WTUlocation not on record	3
Hobart, AU	3
BISHlocation not on record	3
Chapel Hill, US	3
MeiseBGlocation not on record	3
Tromsø, NO	2
Burlington, US	2
New Haven, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
Fort Hayslocation not on record	2
JBRJlocation not on record	1
Champaign, US	1
Columbia, US	1
James Cook Townsvillelocation not on record	1
Brown Universitylocation not on record	1
Jurica-Suchy Nature Museumlocation not on record	1
Davis, US	1
Minia, EG	1
KMNlocation not on record	1
Edmonton, CA	1

38 institutions · 703 of 1 150 vouchered records shown · 74 without an institution code

09Environmental DNA13 detections

Where the DNA of Prasiola stipitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.30 °C -0.2–13.4

Seasonal swing summer↔winter13.1 °C

Max temp (day)12.9 °C 1.40–16.0

Min temp (night)5.80 °C -3.90–11.6

Precipitation121 mm/mo 87.7–141

Air humidity63.1 % 58.7–67.8

Moisture balance41.4 mm/mo

Vapour deficit439 Pa 217–534

Wind speed5.70 m/s

Cloud cover41.9 % 36.5–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Prasiola stipitata

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 047 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 047 records