Praecoxanthus aphyllus

(Benth.) Hopper & A.P.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Praecoxanthus

At a glance

Occurrence records355

Data sources7

Biological traits19

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Praecoxanthus aphyllus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility355 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF355 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Praecoxanthus aphyllus, commonly known as leafless orchid, is the only species of the flowering plant genus Praecoxanthus in the orchid family, Orchidaceae and is endemic to the south-west of Western Australia. Plants in flower lack a true leaf, although those plants that are not flowering do possess a green leaf. This species is one of the first orchids to flower each year and its creamy white, fragrant flower easily distinguishes it from other species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length13 mm

Leaf width7 mm

Plant height0.3 m

Plant height max0.4 m

Plant height min0.2 m

Life cycle & reproduction5

Flowering timennyyynnnnnnn

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Praecoxanthus aphyllus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSGQ866525.1 ↗672 bp

ACGT

ATCATTGTTGAGTCCCAAAGGTGAACGAGCAAATTTGATAACATGTAAACTATAAACATGGTGGCTGCGAAAGTTTGACATCAATCATTT …

Praecoxanthus aphyllus voucher R Heberle ORG 1962 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type355 records

Wild obs. + sensor225

Museum / vouchered130

Origin

Native3

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 100≤1 km 31≤10 km 10>10 km 33

174 georeferenced · 51 without coordinates

Open the mapobservation + sensor225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 22≤1 km 3≤10 km 66>10 km 11

102 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence130

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	86
Canberra, AU	19
Museo Entomologico de Leonlocation not on record	7
Adelaide, AU	6
Mount Annan, AU	3
Smithfield, AU	3
BGPAlocation not on record	3
Brisbane, AU	2
Philadelphia, US	1

9 institutions · 130 of 130 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Praecoxanthus aphyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)