Pouzolzia australis

(Endl.) Friis & Wilmot-Dear · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Pouzolzia

At a glance

Occurrence records124

Data sources8

Biological traits23

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Pouzolzia australis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF124 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Boehmeria australis is a critically endangered large shrub species in the plant family Urticaceae. It is endemic to small islands of Australia and New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length1.25 mm

Leaf length75 mm

Leaf width35 mm

Petiole length2.5 cm

Plant height7 m

Plant height max6 m

Seed mass0.169 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: shrub

Leaf compoundnesssimple

Leaf shapelanceolate widely_ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pouzolzia australis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKT626767.1 ↗1 090 bpNew Zealand · 1994

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACCTATTACACTCCCGAATATGAAACCAAGGATACTGATATTTTAGCAGC …

Pouzolzia australis voucher CHR:500267 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pouzolzia australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora - 25 miscellaneous species. New Zealand J. Bot. 21: 13–20.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type124 records

Wild obs. + sensor6

Museum / vouchered118

Origin

Native17

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2>10 km 2

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 9≤1 km 6≤10 km 30>10 km 1

46 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	28
Wellington, NZ	18
Mount Annan, AU	17
Canberra, AU	16
Museo Entomologico de Leonlocation not on record	15
Christchurch, NZ	15
Kew, GB	2
Hobart, AU	2
Brisbane, AU	2

9 institutions · 115 of 118 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Pouzolzia australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)