Pothos longipes

Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Pothos

At a glance

Occurrence records2 284

Data sources11

Biological traits37

DNA specimens7

eDNA detections3

Sources11 archives

Databases and archives Pothos longipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 284 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF2 284 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Pothos longipes is a climbing plant of the warmer rainforests of eastern Australia. Distributed from Boorganna Nature Reserve in the Mid North Coast of New South Wales to tropical Queensland. This plant is mostly found growing on trunks of trees. An attractive plant with interesting flowers and bright red fruit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length10.5 mm

Leaf length13.5 mm

Leaf length max50 mm

Leaf length min15 mm

Leaf mass per area83.33 g/m2

Leaf size1 350 mm²

Leaf width12 mm

Leaf width max15 mm

Leaf width min5 mm

Plant height22 m

Seed length9 mm

Seed mass109 mg

⚠ sources differ — TRY: 109 mg · AusTraits: 124 mg · GIFT: 109 mg

Seed mass max109 mg

Seed mass min109 mg

Seed volume120 mm³

Seed volume max120 mm³

Seed volume min120 mm³

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnyyyy

Life formclimber

Life spanperennial

Pollination syndromefly

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Climber

Leaf shapeelliptical narrowly_lanceolate oblanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pothos longipes has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496718.1 ↗522 bpAustralia · 2013

ACGT

CAAATTGACTTATTATACTCCTGATTATGCGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCC …

Pothos longipes isolate OF6 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pothos longipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Briggs, B. G., E. Edgar, K. L. Wilson & R. Snow. 2002. Chromosome numbers of some native and naturalised plant species in Australia. Telopea 9: 833–835.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.916 ↗

08Occurrence & distribution

Record type2 284 records

Wild obs. + sensor1 731

Museum / vouchered356

Cultivated / captive6

Other191

Origin

Native58

Introduced1

Range

Area of Occupancy AOO3 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 074≤1 km 284≤10 km 77>10 km 44

1 479 georeferenced · 252 without coordinates

Open the mapobservation + sensor1 731

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 48≤1 km 38≤10 km 133>10 km 45

264 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence356

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1≤10 km 2

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	73
Museo Entomologico de Leonlocation not on record	67
Mount Annan, AU	61
Brisbane, AU	59
Canberra, AU	34
Armidale, AU	17
John T. Waterhouse Herbariumlocation not on record	15
Saint Louis, US	6
NSW Dept of Planning, Industry and Environmentlocation not on record	4
US	3
Honolulu, US	2
Claremont, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Kew, GB	1
Paris, FR	1
Wollongong, AU	1
Zürich, CH	1
La Trobe Universitylocation not on record	1
MeiseBGlocation not on record	1
Auckland, NZ	1
University of the Sunshine Coastlocation not on record	1

21 institutions · 351 of 356 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Pothos longipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 19.0–24.1

Seasonal swing summer↔winter10.6 °C

Max temp (day)28.5 °C 24.1–28.9

Min temp (night)15.0 °C 14.5–19.7

Precipitation132 mm/mo 38.8–240

Air humidity61.0 % 46.9–63.7

Moisture balance13.6 mm/mo -111–69.5

Vapour deficit1,102 Pa 879–1,520

Wind speed3.20 m/s 3.10–3.80

Cloud cover25.6 % 19.6–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pothos longipes

At a glance

Sources11 archives

Size & morphology17

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 284 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 284 records