Potentilla nivea
speciesAt a glance
Occurrence records5 006
Data sources13
Biological traits41
DNA specimens44
eDNA detections23
Sources13 archives
Databases and archives Potentilla nivea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 006 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Occurrence & distributionGBIF5 006 records
Environmental DNA1 datasets · 4 countries23 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 56
01Narrative
Лапча́тка сне́жная — многолетнее травянистое растение, вид рода Лапчатка (Potentilla) семейства Розовые (Rosaceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAGIFTWCVPTRY
Size & morphology11
Leaf length15 mm
Leaf length max20 mm
Leaf length min10 mm
Leaf size362 mm²
Leaf width10.5 mm
Leaf width max13 mm
Leaf width min8 mm
Plant height0.037 m
Plant height max0.22 m
Plant height min0.05 m
Seed mass0.444 mg
Life cycle & reproduction12
DeciduousnessN
Dispersal typeself
Flower length max18 mm
Flower length min10 mm
Flowering endAug
Flowering startJul
Life formperennial
Life spanperennial
Lifespan years20 years
Raunkiær life formhemicryptophyte
Seed number1.4
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatesubalpine or subarctic
Climberself-supporting
Elevation max3 200 m
Elevation mean2 850 m
Elevation min2 500 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb
Habitat GIFTrocks, taluses, stony slopes, alpine meadows
Mycorrhiza typenon-ectomycorrhizal
Woodinessnon-woody
Physiology & chemistry6
Leaf c468 mg/g
Leaf dry-matter content (LDMC)330 mg/g
Leaf n25.9 mg/g
Leaf p2.14 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)13.98 mm²/mg
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Potentilla nivea has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes6
GenBank sequences10
eDNA detections23
Countries6
The DNA barcodea real sequence read deposited for this species
AGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGAGAACGTGTTTCAACGCTTGGAGACGGGGGGCCTCGCG …
Potentilla nivea isolate NIV2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Potentilla nivea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 56 n = 28
Ploidypolyploid inferred
Chromosome records14–702n range42median56mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5611×CCDB · iapt · CCDB · fl-europaea · CCDB · ipcn-api-dl +4
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · fl-europaea — Knaben & Engelskjon,
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · ipcn-api-dl — Petrovsky, V. V. & P. G. ZHUKOVA. 1981. Chromosome numbers and taxonomy of some plant species of Wrangel Island. Bot. Zhurn. 66 (3): 380–387.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · book-northern-plants — Erlandsson' (L. & L. 1942 b).
CCDB · book-atlas-flowering-plants — Erlandsson, L. & L. 1942
CCDB · Cave1956 — Danser. & Steiner
TreeOfSex · plant — Goldblatt1979 ↗
2n 288×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.
CCDB · book-ipcn67-71 — MESICEK, J., & J. SOJAK. 1969. Chromosome counts of some Mongolian plants. Folia Geobot. Phytotax., Praha 4: 55-86.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G., & V.V. PETROVSKY. 1971. Chromosome numbers of certain flowering plants of the Wrangel island. (In Russian). Bot. Zurn. 56: 294-305.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1976
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976
CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1975
CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.
2n 145×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
2n 422×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1995. Chromosome numbers in some species of vascular plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(3): 85–88.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
2n 702×CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-atlas-flowering-plants — Sakai 1934
2n 491×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1976
2n 631×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — B0cher & L. 1950
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 006 records
Wild obs. + sensor2 474
Museum / vouchered2 396
Cultivated / captive3
Other133
Range
Area of Occupancy AOO10 624 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 1 113≤1 km 316≤10 km 530>10 km 341
2 300 georeferenced · 174 without coordinates
Open the mapobservation + sensor2 474
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 126≤1 km 295≤10 km 364>10 km 230
1 015 georeferenced · 1 381 without coordinates
Open the institutions mapphysical evidence2 396
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 3 records without
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions86 of 149 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 322 |
| Trondheim, NO | 228 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 201 |
| LDlocation not on record | 131 |
| Uppsala, SE | 122 |
| TROMlocation not on record | 84 |
| Helsinki, FI | 74 |
| Stockholm, SE | 53 |
| Québec, CA | 51 |
| Zürich, CH | 49 |
| Oskarshamn, SE | 42 |
| Tsukuba, JP | 34 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 33 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 33 |
| University of Alberta Museumslocation not on record | 33 |
| Zürich, CH | 32 |
| WTUlocation not on record | 32 |
| Victoria, CA | 28 |
| University of Stellenboschlocation not on record | 27 |
| Denver, US | 26 |
| Beijing, CN | 24 |
| Urumqi, CN | 23 |
| Bronx, US | 23 |
| IB FRC Komi SC UB RASlocation not on record | 21 |
| Oulu, FI | 21 |
| Olocation not on record | 21 |
| Rocky Mountain Biological Laboratorylocation not on record | 20 |
| Komarov Botanical Institutelocation not on record | 20 |
| Pullman, US | 20 |
| Vancouver, CA | 17 |
| Chongqing Museumlocation not on record | 15 |
| Whitehorse, CA | 15 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Beijing Normal Universitylocation not on record | 13 |
| BRNUlocation not on record | 12 |
| Toronto, CA | 11 |
| Turku, FI | 11 |
| Montréal, CA | 10 |
| Durango, US | 10 |
| Missoula, US | 9 |
| IWEP FEB RASlocation not on record | 9 |
| SLU Artdatabankenlocation not on record | 9 |
| Anchorage, US | 9 |
| Bern, CH | 9 |
| Claremont, US | 9 |
| Kuopio, FI | 9 |
| Yukon Universitylocation not on record | 8 |
| Université Lavallocation not on record | 8 |
| Lanzhou, CN | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 7 |
| St. Paul, US | 7 |
| Copenhagen, DK | 7 |
| GZUlocation not on record | 6 |
| University of Lethbridgelocation not on record | 6 |
| Flagstaff, US | 6 |
| Logan, US | 6 |
| Canadian Museum of Naturelocation not on record | 5 |
| GJOlocation not on record | 5 |
| Kunming, CN | 5 |
| Paris, FR | 5 |
| Provo, US | 5 |
| Frankfurt am Main | 5 |
| Edinburgh, GB | 4 |
| Salzburg, AT | 4 |
| Kyoto Universitylocation not on record | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| Churchill Northern Studies Centrelocation not on record | 4 |
| Tampa, US | 4 |
| Riverside, US | 3 |
| nbflocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Xining, CN | 3 |
| nlocation not on record | 3 |
| Bergen, NO | 3 |
| Yangling, CN | 3 |
| DULlocation not on record | 3 |
| Saint Louis, US | 3 |
| Bloomington, US | 3 |
| Jyväskylä, FI | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| Albuquerque, US | 3 |
| Moscow, US | 3 |
| Berlin, DE | 3 |
| Guilin, CN | 2 |
| BClocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| Dresden, DE | 2 |
| Saint John, CA | 2 |
| Bangkok, TH | 2 |
| Dhaka, BD | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| ASUlocation not on record | 2 |
| Pechora-Ilych Nature Reservelocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Philadelphia, US | 2 |
| SZUlocation not on record | 2 |
| Beijing, CN | 2 |
| Wellington, NZ | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Göteborg, SE | 1 |
| US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| WINlocation not on record | 1 |
| Nanjing, CN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Pittsburg, US | 1 |
| Porvoo, FI | 1 |
| Williamsburg, US | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Dekalb, US | 1 |
| Tempe, US | 1 |
| Karlsruhe, DE | 1 |
| Tromso University Museumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Orem, US | 1 |
| Davenport, US | 1 |
| Columbia, US | 1 |
| Bourges, FR | 1 |
| Martin-Luther-Universität Halle-Wittenberglocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Rovaniemi, FI | 1 |
| Kew, GB | 1 |
| USFSlocation not on record | 1 |
| Görlitz, DE | 1 |
| Davis, US | 1 |
| New Brunswick, US | 1 |
| BioFokuslocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Boise, US | 1 |
| Pocatello, US | 1 |
| Podgorica, ME | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| CJBGlocation not on record | 1 |
| University of Oslo, Natural History Museumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Bozeman, US | 1 |
| ENTClocation not on record | 1 |
| Urumqi, CN | 1 |
| Grand Junction, US | 1 |
| Wuzhou, CN | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| GINRlocation not on record | 1 |
| Emporia, US | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
149 institutions · 2 272 of 2 396 vouchered records shown · 124 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Potentilla nivea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map4 countries0
Nutrient enriched sheep lie over unglaciated…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.8 °C 8.00–12.9
Seasonal swing summer↔winter36.7 °C
Max temp (day)14.6 °C 11.7–17.6
Min temp (night)7.10 °C 4.70–8.40
Precipitation92.2 mm/mo 46.6–116
Air humidity61.1 % 57.8–64.0
Moisture balance-0.1 mm/mo
Vapour deficit503 Pa 391–619
Wind speed2.90 m/s
Cloud cover53.5 % 44.1–67.1
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.