Potentilla argentea
speciesAt a glance
Occurrence records152 124
Data sources9
Biological traits50
DNA specimens33
eDNA detections16
Sources9 archives
Databases and archives Potentilla argentea's data was compiled from.
GBIFGlobal Biodiversity Information Facility152 124 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources50 traits
Chemical compositionNPASS2 compounds
Occurrence & distributionGBIF152 124 records
Environmental DNA1 datasets · 4 countries16 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceGoaT225 Mbp
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology18
Leaf length20 mm
Leaf length max30 mm
Leaf length min10 mm
Leaf mass31.58 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 527 mm² · GIFT: 527 mm²
Leaf width7.5 mm
Leaf width max10 mm
Leaf width min5 mm
Plant height0.252 m
⚠ sources differ — GIFT: 0.252 m · LEDA: 0.235 m · TRY: 0.267 m
Plant height generative0.22 m
Plant height max0.5 m
Plant height min0.1 m
Seed length0.6 mm
⚠ sources differ — TRY: 0.6 mm · GIFT: 0.9 mm
Seed length max0.9 mm
Seed length min0.9 mm
Seed mass0.08 mg
⚠ sources differ — TRY: 0.08 mg · LEDA: 0.094 mg · GIFT: 0.09 mg
Seed mass max0.09 mg
Seed mass min0.073 mg
Life cycle & reproduction14
Deciduousnesspartly evergreen
⚠ sources differ — TRY: partly evergreen · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typehuman
Flowering endJul
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Seed number3 300
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climberself-supporting
Elevation max3 100 m
Elevation mean1 100 m
Elevation min1 100 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTcrop fields, forest, meadows
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)312 mg/g
⚠ sources differ — TRY: 312 mg/g · LEDA: 262 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)17.52 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition2 compounds
Compounds documented for Potentilla argentea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Tropane alkaloids1
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| STECJAGHUSJQJN-FWXGHANASA-N | present | NPASS |
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Potentilla argentea has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes6
GenBank sequences10
eDNA detections16
Countries5
The DNA barcodea real sequence read deposited for this species
GGGAAGCCTCGCGTGTGGTGCTTGGGCGCTTCCGTTTGGCCGACCTCTCCGGGCGTACTGAACATCGGTGTGAATTGCGCCAAGCAACTT …
Potentilla argentea voucher KS23 HER0586 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL7★rbcLa★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceGoaT
The complete instruction manual Potentilla argentea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size224 940 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
THIS GENOME Potentilla argentea0.22 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Chromosome records14–142n range14median14mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 142×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Tree of Sex Database — ↗
08Occurrence & distribution
Record type152 124 records
Wild obs. + sensor135 206
Museum / vouchered15 955
Cultivated / captive49
Fossil2
Other912
Origin
Native1 772
Introduced109
Range
Area of Occupancy AOO273 608 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 50 319≤1 km 16 660≤10 km 40 084>10 km 1 317
108 380 georeferenced · 26 826 without coordinates
Open the mapobservation + sensor135 206
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 2 287≤1 km 2 575≤10 km 4 954>10 km 610
10 426 georeferenced · 5 529 without coordinates
Open the institutions mapphysical evidence15 955
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 21
23 georeferenced · 26 without coordinates
Open the mapnot free-living49
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions150 of 264 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 906 |
| Moscow State Universitylocation not on record | 825 |
| SLU Artdatabankenlocation not on record | 624 |
| LDlocation not on record | 485 |
| DBF-NHMDlocation not on record | 466 |
| Helsinki, FI | 358 |
| Adam Mickiewicz University in Poznańlocation not on record | 336 |
| Frankfurt am Main | 314 |
| Olocation not on record | 290 |
| Madison, US | 228 |
| MeiseBGlocation not on record | 225 |
| Trondheim, NO | 215 |
| Uniwersytet Jagiellońskilocation not on record | 201 |
| Görlitz, DE | 182 |
| Oskarshamn, SE | 180 |
| Tartu, EE | 178 |
| Uniwersytet Warszawskilocation not on record | 170 |
| KMNlocation not on record | 159 |
| BIO-UNIPIlocation not on record | 144 |
| Bergen, NO | 144 |
| Zürich, CH | 141 |
| Philadelphia, US | 135 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 134 |
| Zürich, CH | 133 |
| St. Paul, US | 125 |
| Québec, CA | 125 |
| Berlin, DE | 121 |
| Voronezh State Universitylocation not on record | 118 |
| GJOlocation not on record | 107 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 107 |
| BRNUlocation not on record | 106 |
| BFLlocation not on record | 105 |
| Chongqing Museumlocation not on record | 96 |
| Philadelphia, US | 94 |
| Salzburg, AT | 92 |
| Ann Arbor, US | 82 |
| Jyväskylä, FI | 80 |
| Bronx, US | 75 |
| University of New Hampshirelocation not on record | 71 |
| Provincia di Livornolocation not on record | 71 |
| Bern, CH | 67 |
| Burlington, US | 59 |
| BDBClocation not on record | 58 |
| Uppsala, SE | 56 |
| València, ES | 52 |
| Université Lavallocation not on record | 49 |
| GZUlocation not on record | 49 |
| Mlocation not on record | 40 |
| TROMlocation not on record | 36 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Wlocation not on record | 35 |
| New Haven, US | 34 |
| Green Bay, US | 33 |
| Tallinn, EE | 32 |
| Bloomington, US | 32 |
| South Kensington, GB | 32 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 32 |
| Montréal, CA | 32 |
| Brussel, BE | 30 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 29 |
| Allentown, US | 28 |
| Saint John, CA | 27 |
| Entomological Society of Latvialocation not on record | 27 |
| Barcelona, ES | 27 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 26 |
| WTUlocation not on record | 26 |
| MAlocation not on record | 25 |
| Acadia Universitylocation not on record | 24 |
| Wuzhou, CN | 24 |
| Christchurch, NZ | 23 |
| BClocation not on record | 23 |
| Karlsruhe, DE | 21 |
| Vitoria, ES | 21 |
| Toronto, CA | 20 |
| WINlocation not on record | 19 |
| Tula State Universitylocation not on record | 19 |
| Pullman, US | 19 |
| Oulu, FI | 19 |
| Urumqi, CN | 18 |
| Uniwersytet Śląski w Katowicachlocation not on record | 17 |
| Beijing, CN | 16 |
| Missoula, US | 15 |
| Tampa, US | 15 |
| Victoria, CA | 15 |
| Museo Entomologico de Leonlocation not on record | 14 |
| Salamanca, ES | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Kuopio, FI | 13 |
| SWlocation not on record | 13 |
| Xiamen, CN | 13 |
| Keene State Universitylocation not on record | 12 |
| Vancouver, CA | 12 |
| CJBGlocation not on record | 12 |
| College Park, US | 12 |
| Moscow, US | 11 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Sion, CH | 11 |
| H-Schuhwlocation not on record | 11 |
| Lausanne, CH | 10 |
| Turku, FI | 10 |
| PRClocation not on record | 10 |
| Stockholm, SE | 10 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 10 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 9 |
| WNNUlocation not on record | 9 |
| Wellington, NZ | 9 |
| IWEP FEB RASlocation not on record | 9 |
| University of Alberta Museumslocation not on record | 9 |
| New Brunswick, US | 8 |
| Madrid, ES | 8 |
| Chadron, US | 8 |
| Staten Island, US | 8 |
| Millersville, US | 7 |
| Urumqi, CN | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| McWane Science Centerlocation not on record | 7 |
| Canberra, AU | 7 |
| Durham, US | 7 |
| Whitewater, US | 7 |
| Paris, FR | 7 |
| University of Stellenboschlocation not on record | 7 |
| Podgorica, ME | 6 |
| Bozeman, US | 6 |
| Uniwersytet Opolskilocation not on record | 6 |
| San Sebastián, ES | 6 |
| Umeå Universitylocation not on record | 6 |
| Pamplona, ES | 6 |
| Yangling, CN | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Dekalb, US | 6 |
| Whitehorse, CA | 5 |
| Glarus, CH | 5 |
| Tilburg, NL | 5 |
| Davenport, US | 5 |
| Denver, US | 5 |
| UGentlocation not on record | 5 |
| Saint Louis, US | 5 |
| SZUlocation not on record | 5 |
| Brookings, US | 5 |
| Corvallis, US | 4 |
| Bangkok, TH | 4 |
| Auckland, NZ | 4 |
| Hamilton, US | 4 |
| Dresden, DE | 4 |
| Philadelphia, US | 4 |
| Bourges, FR | 4 |
| Alicante, ES | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| Columbia, US | 4 |
| BSBIlocation not on record | 4 |
| Adelaide, AU | 4 |
| Porrentruy, CH | 4 |
| Riverside, US | 4 |
| Kew, GB | 3 |
| Oswego, US | 3 |
| Hudson, US | 3 |
| Spearfish, US | 3 |
| Williamsburg, US | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Taipei, TW | 3 |
| nbflocation not on record | 3 |
| No collectionlocation not on record | 3 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 3 |
| Cheney, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Nijmegen, NL | 2 |
| Boise, US | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| H-Dunkellocation not on record | 2 |
| Universität Erlangen-Nürnberglocation not on record | 2 |
| ASUlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Santa Barbara, US | 2 |
| Bend, US | 2 |
| Samara National Research Universitylocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Hobart, AU | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Granada, ES | 2 |
| Mohonk Preservelocation not on record | 2 |
| Lanzhou, CN | 2 |
| Ypsilanti, US | 2 |
| Chengdu, CN | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Monastir, TN | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| IDElocation not on record | 2 |
| Dhaka, BD | 2 |
| Flagstaff, US | 2 |
| Frauenfeld, CH | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| San Angelo, US | 1 |
| PUC-RSlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Mississippi State, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Kingston, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| LUXEMBOURG, LU | 1 |
| IPE-CSIClocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Namur, BE | 1 |
| Ivano-Frankove, UA | 1 |
| Pittsburg, US | 1 |
| CICYTEXlocation not on record | 1 |
| Norfolk, US | 1 |
| USFS/BHSClocation not on record | 1 |
| Xining, CN | 1 |
| Xian, CN | 1 |
| Jaén, ES | 1 |
| DULlocation not on record | 1 |
| Kunming, CN | 1 |
| Rotorua, NZ | 1 |
| Macomb, US | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| Gijón, ES | 1 |
| Brock University (BU)location not on record | 1 |
| Mexico City, MX | 1 |
| Cambridge, US | 1 |
| US | 1 |
| Pamplona, ES | 1 |
| Fribourg, CH | 1 |
| Madrid, ES | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Phoenix, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Provo, US | 1 |
| Fredericksburg, US | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Washington, US | 1 |
| POL003location not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Knoxville, US | 1 |
| H-Hohlalocation not on record | 1 |
| BMlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Miami, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| EL PASO, US | 1 |
| Caldwell, US | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Claremont, US | 1 |
| Chicago, US | 1 |
| Durham, US | 1 |
| Santiago de Compostela, ES | 1 |
| ULBF-AGRlocation not on record | 1 |
| AUAlocation not on record | 1 |
264 institutions · 13 786 of 15 955 vouchered records shown · 1 772 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Potentilla argentea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.2 °C 7.80–17.4
Seasonal swing summer↔winter14.9 °C
Max temp (day)18.2 °C 10.1–20.2
Min temp (night)11.2 °C 3.60–14.1
Precipitation78.6 mm/mo 65.0–98.6
Air humidity61.0 % 57.4–63.5
Moisture balance-13.8 mm/mo
Vapour deficit583 Pa 407–754
Wind speed3.00 m/s
Cloud cover39.3 % 37.9–52.7
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.