Polyzosteria limbata

Burmeister, 1838 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Blattodea/Blattidae/Polyzosteria

At a glance

Occurrence records422

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Polyzosteria limbata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility422 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF422 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Polyzosteria limbata, the Botany Bay cockroach is an insect found in south eastern Australia.http://www.ento.csiro.au/aicn/name_c/a_516.htm

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polyzosteria limbata has left across the world's sequence archives.

At a glance

DNA specimens4

BINs3

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes2

BINs3

Most divergent pair1.4%

Where individuals differ — all 20 variable positions, in barcode order

7Avariable

31Gmostly conserved

85Avariable

115Tmostly conserved

173Cmostly conserved

184Amostly conserved

197Cmostly conserved

214Gmostly conserved

268Amostly conserved

295Cmostly conserved

373Avariable

424Cvariable

496Cmostly conserved

547Cvariable

550Amostly conserved

562Avariable

595Cvariable

616Cvariable

631Amostly conserved

634Tmostly conserved

AACCTTATATTTCATTTTTGGTGCTTGATCGGGAATAGTAGGAACATCATTAAGAATATTAATTCGAGCAGAGCTAGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euzosteria tuberculatasame family12.0%Euzosteria subverrucosasame family12.8%Megazosteria shawisame family12.8%Polyzosteria magnasame genus13.1%Polyzosteria cupreasame genus13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type422 records

Wild obs. + sensor271

Museum / vouchered151

Range

Area of Occupancy AOO964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 129≤1 km 46≤10 km 24>10 km 21

220 georeferenced · 51 without coordinates

Open the mapobservation + sensor271

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 7≤10 km 49>10 km 8

64 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	70
Sydney, AU	69
Western Australian Museumlocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	3
Museums Victorialocation not on record	2
DPIlocation not on record	1

6 institutions · 149 of 151 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Polyzosteria limbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 16.2–23.7

Seasonal swing summer↔winter9.80 °C

Max temp (day)23.3 °C 20.9–25.7

Min temp (night)16.8 °C 11.9–21.6

Precipitation277 mm/mo 127–426

Air humidity64.1 % 63.2–65.0

Vapour deficit859 Pa 685–1,032

Cloud cover33.0 % 21.7–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)