Polytremis pellucida

(Murray, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Polytremis

At a glance

Occurrence records246

Data sources8

Biological traits0

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Polytremis pellucida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF246 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT2n = 32

01Narrative

Polytremis pellucida is a butterfly belonging to the family Hesperiidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polytremis pellucida has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes2

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)6.0%

Haplotypes2

BINs3

Most divergent pair7.6%

Where individuals differ — all 70 variable positions, in barcode order

22Avariable

29Avariable

30Cvariable

38Tmostly conserved

49Avariable

50Tmostly conserved

112Tmostly conserved

118Tmostly conserved

124Tmostly conserved

127Tmostly conserved

139Tmostly conserved

142Tmostly conserved

154Tmostly conserved

184Avariable

197Tmostly conserved

202Tmostly conserved

217Cvariable

220Cvariable

223Tmostly conserved

235Cmostly conserved

238Cmostly conserved

241Avariable

250Cvariable

271Cmostly conserved

274Cvariable

283Amostly conserved

284Cmostly conserved

286Avariable

287Tmostly conserved

292Tmostly conserved

325Tmostly conserved

328Tmostly conserved

337Tmostly conserved

340Cvariable

343Cmostly conserved

347Cmostly conserved

349Cmostly conserved

364Cmostly conserved

367Cmostly conserved

397Tmostly conserved

400Cmostly conserved

403Tmostly conserved

428Cvariable

430Avariable

463Tmostly conserved

479Tmostly conserved

481Amostly conserved

490Tmostly conserved

499Tvariable

508Tmostly conserved

514Tmostly conserved

517Amostly conserved

523Cvariable

529Avariable

530Tmostly conserved

539Cvariable

541Avariable

553Amostly conserved

571Tmostly conserved

574Tmostly conserved

581Cvariable

583Avariable

586Amostly conserved

596Avariable

619Tmostly conserved

620Gmostly conserved

622Tmostly conserved

631Amostly conserved

641Cmostly conserved

643Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAACAGGAATATTAGGAACATCATTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pelopidas conjunctasame family5.2%Tsukiyamaia albimaculasame family6.2%Thymelicus hamzasame family6.7%Oligoria percosiussame family6.8%Pelopidas agnasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Polytremis pellucida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records16–322n range24median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 321×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type246 records

Wild obs. + sensor83

Museum / vouchered163

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 29≤1 km 10≤10 km 4>10 km 12

55 georeferenced · 28 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 4≤10 km 10>10 km 23

37 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Obihiro Centennial City Museumlocation not on record	39
Toyota city nature sanctuarylocation not on record	21
Helsinki, FI	19
RCMlocation not on record	18
Kushiro City Museumlocation not on record	17
Cambridge, US	14
Taiwan Forestry Research Institutelocation not on record	8
Sanda, JP	7
Tartu, EE	6
Gifu prefectural Museumlocation not on record	6
MZLUlocation not on record	2
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
Chiba, JP	1
Ishikawa Museum of Natural Historylocation not on record	1
Gyeryonsan Natural History Museumlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

16 institutions · 162 of 163 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Polytremis pellucida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 8.00–12.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)13.6 °C 10.4–16.8

Min temp (night)5.10 °C 3.40–6.80

Precipitation235 mm/mo 148–323

Air humidity61.0 % 57.8–64.2

Moisture balance143 mm/mo 47.2–239

Vapour deficit560 Pa 454–666

Wind speed3.40 m/s 3.00–3.70

Cloud cover40.1 % 36.6–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)