Polythysana cinerascens

Philippi, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Polythysana

At a glance

Occurrence records200

Data sources7

Biological traits0

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Polythysana cinerascens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

01Narrative

Polythysana cinerascens is a species of moth of the family Saturniidae. It is found in Chile. Larvae have been recorded on Lithraea caustica.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polythysana cinerascens has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

40Gmostly conserved

88Tvariable

133Amostly conserved

206Tmostly conserved

268Gmostly conserved

370Amostly conserved

401Cmostly conserved

412Amostly conserved

520Gvariable

571Tvariable

625Avariable

646Tmostly conserved

AACTTTATACTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACTTCATTAAGTTTATTAATTCGAGCAGAACTAGGAACTCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes4

BIN1

Most divergent pair1.5%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polythysana apollinasame genus4.1%Polythysana rubrescenssame genus4.9%Hylesia remisionexsame family9.4%Psilocorsis argutasame order10.0%Sericosema warnerisame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type200 records

Wild obs. + sensor194

Museum / vouchered6

Origin

Native1

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 88≤1 km 49≤10 km 19>10 km 16

172 georeferenced · 22 without coordinates

Open the mapobservation + sensor194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 1>10 km 2

4 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	2
Denver, US	1
UDEClocation not on record	1
Auckland, NZ	1
Research Collection of Eric Van Schaycklocation not on record	1

5 institutions · 6 of 6 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Polythysana cinerascens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 10.0–17.9

Seasonal swing summer↔winter12.4 °C

Max temp (day)21.7 °C 14.9–24.8

Min temp (night)9.70 °C 6.10–12.8

Precipitation47.4 mm/mo 20.2–274

Air humidity55.0 % 51.3–62.7

Moisture balance-57.2 mm/mo -113–220

Vapour deficit769 Pa 480–977

Wind speed2.80 m/s 2.30–3.30

Cloud cover14.4 % 8.30–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)