Polytela gloriosae

Fabricius, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Polytela

At a glance

Occurrence records947

Data sources8

Biological traits0

DNA specimens5

eDNA detections6

Sources8 archives

Databases and archives Polytela gloriosae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility947 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF947 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT2n = 62

01Narrative

Polytela gloriosae, the Indian lily moth or lily caterpillar, is a moth of the family Noctuidae. The species was first described by Johan Christian Fabricius in 1781. It is found in Sri Lanka, India and probably in Indonesia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polytela gloriosae has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes1

BIN1

Where individuals differ — all 24 variable positions, in barcode order

146Amostly conserved

150Tmostly conserved

152Tmostly conserved

154Tmostly conserved

155Tmostly conserved

156Tmostly conserved

158Amostly conserved

159Tmostly conserved

161Gmostly conserved

162Tmostly conserved

163Tmostly conserved

164Amostly conserved

166Amostly conserved

167Cmostly conserved

168Cmostly conserved

172Tmostly conserved

173Amostly conserved

175Amostly conserved

177Tmostly conserved

181Amostly conserved

184Amostly conserved

195Gmostly conserved

196Amostly conserved

271Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lacanobia atlanticasame family4.4%Sideridis egenasame family4.4%Conisania aridasame family4.6%Lacanobia splendenssame family4.6%Papestra birensame family4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Polytela gloriosae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 311×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 621×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type947 records

Wild obs. + sensor945

Museum / vouchered2

Range

Area of Occupancy AOO2 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 290≤1 km 209≤10 km 87>10 km 39

625 georeferenced · 320 without coordinates

Open the mapobservation + sensor945

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA6 detections

Where the DNA of Polytela gloriosae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

Belladonna lily

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–27.9

Seasonal swing summer↔winter6.10 °C

Max temp (day)30.5 °C 29.0–31.3

Min temp (night)22.1 °C 19.6–23.2

Precipitation109 mm/mo 63.9–329

Air humidity59.3 % 53.9–63.5

Moisture balance-17.8 mm/mo -91.9–167

Vapour deficit1,393 Pa 1,214–1,609

Wind speed1.80 m/s 1.40–3.20

Cloud cover31.2 % 23.0–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)