Polygonum polygaloides

Meisn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Polygonum

At a glance

Occurrence records358

Data sources8

Biological traits13

DNA specimens10

eDNA detections7

Sources8 archives

Databases and archives Polygonum polygaloides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility358 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF358 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Polygonum polygaloides is a North American species of flowering plants in the buckwheat family known by the common names milkwort knotweed and polygala knotweed. It is native to much of western North America, where it can be found in many types of moist habitat. It is a variable species, usually divided into a number of subspecies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.572 mg

⚠ sources differ — TRY: 0.572 mg · GIFT: 0.38 mg

Seed mass max0.57 mg

Seed mass min0.189 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonum polygaloides has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSGQ340010.1 ↗506 bpUSA · 1983

ACGT

CCCGCGAACCCGTTCACAACACCAAGCCCGGGCCCGGTCCCGGCACCAACACAACCCCGGCGCGGATTGCGCCAAGGACCACGAACAGAA …

Polygonum polygaloides subsp. kelloggii voucher LE<RUS>:Neese et al. N14059 internal transcribed spacer 1, partial sequence; and 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★rbcLa★trnL-F★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type358 records

Wild obs. + sensor101

Museum / vouchered257

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 67≤1 km 8≤10 km 1>10 km 8

84 georeferenced · 17 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 21≤1 km 62≤10 km 55>10 km 5

143 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	50
Moscow, US	35
Pullman, US	35
Bronx, US	21
Pocatello, US	12
CASlocation not on record	11
Madison, US	10
Boise, US	9
Logan, US	7
Denver, US	5
Cheney, US	5
Caldwell, US	5
Bangkok, TH	4
DOI/NPS, Colonial National Historical Parklocation not on record	4
University of British Columbia, Herbariumlocation not on record	4
Tacoma, US	2
Claremont, US	2
Davis, US	2
Missoula, US	2
Truckee, US	2
Riverside, US	2
Corvallis, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
San Luis Obispo, US	1
Tampa, US	1
Provo, US	1
Beijing, CN	1
Whitewater, US	1
Brookings, US	1
Albuquerque, US	1
IDElocation not on record	1
Canadian Department of Agriculturelocation not on record	1
University of Stellenboschlocation not on record	1
San Diego, US	1
Rocky Mountain Biological Laboratorylocation not on record	1
University of Alberta Museumslocation not on record	1
Flagstaff, US	1

37 institutions · 246 of 257 vouchered records shown · 11 without an institution code

09Environmental DNA7 detections

Where the DNA of Polygonum polygaloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Moist drainage depression in meadowFlat open meadow, moist in spring, on sagebr…Pathside clearing with Achillea millefolium,…Associated taxa: Myosotis, Veroncia, Lupinus…depressionWet forest, subalpine fir/Globe huckleberry-…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 8.60–13.8

Seasonal swing summer↔winter21.5 °C

Max temp (day)19.4 °C 15.2–20.7

Min temp (night)6.00 °C 2.10–7.80

Precipitation63.6 mm/mo 52.3–94.1

Air humidity55.0 % 49.4–57.8

Moisture balance-64.3 mm/mo -82.5–-27.8

Vapour deficit699 Pa 487–770

Wind speed3.20 m/s 1.90–3.60

Cloud cover38.5 % 27.9–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)