Polygonum oxyspermum

C.A.Mey. & Bunge · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Polygonum

At a glance

Occurrence records3 427

Data sources9

Biological traits30

DNA specimens15

eDNA detections11

Sources9 archives

Databases and archives Polygonum oxyspermum's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF3 427 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB · GoaT2n = 40

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology8

Leaf size316 mm²

Plant height0.325 m

⚠ sources differ — GIFT: 0.325 m · LEDA: 0.55 m · TRY: 0.2 m

Plant height generative0.55 m

Plant height max0.4 m

Plant height min0.02 m

Seed mass3.42 mg

Seed mass max3.3 mg

Seed mass min3.29 mg

Life cycle & reproduction11

Deciduousnessevergreen

⚠ sources differ — TRY: always summer green · GIFT: deciduous

Dehiscenceindehiscent

Dispersal typewater

Flowering endOct

Flowering startJul

Life formannual or biennial

Life spanannual

⚠ sources differ — TRY: Annual · GIFT: perennial

Lifespan years4 years

Pollination syndromeinsect

Raunkiær life formtherophyte

Self fertilizationpresent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typegenerative dispersule

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonum oxyspermum has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes5

GenBank sequences9

eDNA detections11

Countries5

The DNA barcodea real sequence read deposited for this species

ITSGQ339943.1 ↗543 bpUnited Kingdom · 2003

ACGT

TCGAAACCTGCGAGAGCAGAAAGACCCGCGAACACGTTGTTAAACACAAAGCCCGGGCCCACGAGGCCCGGCACCAACCAAACCCCGGCG …

Polygonum oxyspermum subsp. raii voucher MW<RUS>:Seregin N480 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Polygonum oxyspermum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–802n range40median40mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4012×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · brit-fl +5

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · ita-fl — RAFFAELLI M. - 1981. Contributi alla conoscenza del genere Polygonum L. 3. Polygonum robertii Loisel.. Webbia , 35(1): 63-77.

CCDB · brit-fl — Love, µ., Love, D. Opera Bot. 5: 363-373 (1961)

CCDB · brit-fl — Styles, B.T. Watsonia 5: 177-214 (1962)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2018

CCDB · fl-europaea — Styles , 1962

CCDB · ipcn-api-dl — Wolf, S. J. & J. McNeill. 1987. Cytotaxonomic studies on Polygonum section Polygonum in eastern Canada and the adjacent United States. Canad. J. Bot. 65: 647–652.

CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.

CCDB · ipcn-api-dl — Raffaelli, M. 1981. Contributi alla conoscenza del genere Polygonum L. III. Polygonum robertii Loisel. Webbia 35: 63–77.

CCDB · eflora

CCDB · Cave1962 — Styles 1962

2n 601×CCDB · Cave1956

CCDB · Cave1956 — Love & Love a

2n 801×CCDB · Cave1956

CCDB · Cave1956 — Love & Love a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 427 records

Wild obs. + sensor3 203

Museum / vouchered223

Cultivated / captive1

Origin

Native1 830

Introduced2

Range

Area of Occupancy AOO4 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 644≤1 km 616≤10 km 1 929>10 km 5

3 194 georeferenced · 9 without coordinates

Open the mapobservation + sensor3 203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 11≤1 km 15≤10 km 29>10 km 10

65 georeferenced · 158 without coordinates

Open the institutions mapphysical evidence223

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	80
Oskarshamn, SE	31
Clocation not on record	23
Uppsala, SE	15
Olocation not on record	7
SLU Artdatabankenlocation not on record	7
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	6
South Kensington, GB	6
Bergen, NO	5
BSBIlocation not on record	5
KMNlocation not on record	4
TROMlocation not on record	3
National Museum Waleslocation not on record	3
Trondheim, NO	3
Finnish Museum of Natural Historylocation not on record	2
Jyväskylä, FI	2
Acadia Universitylocation not on record	1
IPSlocation not on record	1
Chicago, US	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Montréal, CA	1
Natural History Museum Rotterdamlocation not on record	1
Göteborg, SE	1

23 institutions · 209 of 223 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Polygonum oxyspermum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

on sandy sea shore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 2.00–16.4

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.3 °C 4.90–17.8

Min temp (night)10.1 °C -1.30–15.0

Precipitation75.7 mm/mo 52.9–166

Air humidity63.7 % 61.5–65.6

Moisture balance16.9 mm/mo

Vapour deficit540 Pa 349–702

Wind speed5.30 m/s

Cloud cover49.8 % 45.7–53.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polygonum oxyspermum

At a glance

Sources9 archives

Size & morphology8

Life cycle & reproduction11

Diet & foraging2

Habitat & environment7

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 427 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 427 records