Polygonum cognatum

Meisn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Polygonum

At a glance

Occurrence records407

Data sources11

Biological traits23

DNA specimens2

eDNA detections6

Sources11 archives

Databases and archives Polygonum cognatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF407 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Polygonum cognatum, commonly called Indian knotgrass or madimak (from Turkish madımakProf. Dr. Turhan Baytop (1997), Türkçe Bitki Adları Sözlüğü, TDK yayınları: 578, Ankara, 1997), is an edible weedy creeping perennial herb in the genus Polygonum, frequently eaten by people of Turkey. It has larger leaves than most other species of Polygonum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf length15 mm

Leaf length max20 mm

Leaf length min10 mm

Leaf width max13 mm

Leaf width min5 mm

Plant height max0.13 m

Plant height min0.05 m

Seed mass3.52 mg

Life cycle & reproduction4

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 700 m

Elevation mean3 300 m

Elevation min1 000 m

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition11 compounds

Compounds documented for Polygonum cognatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols5

Simple phenolic acids2

Cinnamic acids and derivatives $ Simple phenolic acids1

Gallotannins $ Simple phenolic acids1

Stigmastane steroids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
3-O-Methylkaempferol	present	LOTUS
4-Hydroxybenzoic acid	present	LOTUS
Astragalin	present	LOTUS
beta-Sitosterol	present	LOTUS
Chrysin	present	LOTUS
Gallic acid	present	LOTUS
protocatechuate	present	LOTUS
Quercetin 3-O-methyl-ether	present	LOTUS
Quercetin 3-rutinoside	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonum cognatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP232200.1 ↗405 bpTurkey

ACGT

GTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCCTCGTGGCCAGGGCACGTCTGTTTGGGCGTCA …

Polygonum cognatum voucher VLB123 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Polygonum cognatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 301×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type407 records

Wild obs. + sensor133

Museum / vouchered256

Other18

Origin

Introduced9

Range

Area of Occupancy AOO996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 8≤1 km 4≤10 km 90>10 km 16

118 georeferenced · 15 without coordinates

Open the mapobservation + sensor133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 3≤1 km 3≤10 km 94>10 km 20

120 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GMBAlocation not on record	110
Wlocation not on record	44
Beijing, CN	27
Urumqi, CN	20
Moscow State Universitylocation not on record	17
WNNUlocation not on record	6
Paris, FR	4
Urumqi, CN	4
Salamanca, ES	4
Berlin, DE	4
Kunming, CN	3
BRNUlocation not on record	3
Kew, GB	2
Xian, CN	2
Rishon Le Zion, IL	1
Lanzhou Institute of Desert Research, Academia Sinicalocation not on record	1
MAlocation not on record	1
BGBMlocation not on record	1
South Kensington, GB	1

19 institutions · 255 of 256 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Polygonum cognatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median0.7 °C 0.7–3.60

Seasonal swing summer↔winter24.1 °C

Max temp (day)4.20 °C 4.20–8.10

Min temp (night)-5.00 °C -5.00–-1.50

Precipitation61.2 mm/mo 38.0–61.2

Air humidity57.2 % 56.3–57.2

Moisture balance-28.7 mm/mo -50.9–-28.7

Vapour deficit326 Pa 326–516

Wind speed4.20 m/s 4.20–4.90

Cloud cover29.4 % 29.4–37.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)