Polygonum aviculare
speciesAt a glance
Occurrence records513 970
Data sources8
Biological traits78
DNA specimens122
eDNA detections89
Sources8 archives
Databases and archives Polygonum aviculare's data was compiled from.
GBIFGlobal Biodiversity Information Facility513 970 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics122 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources78 traits
Chemical compositionNPASS54 compounds
Occurrence & distributionGBIF513 970 records
Environmental DNA1 datasets · 13 countries89 detections
DNA & barcodingBOLD · NCBI122 specimens
Genome at a glanceGoaT · NCBI910 Mbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology26
Fruit length2.5 mm
⚠ sources differ — AusTraits: 2.5 mm · GIFT: 2.88 mm
Fruit length max3 mm
Fruit length min2 mm
Fruit width1.65 mm
Leaf length30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 25 mm
Leaf length max50 mm
Leaf length min10 mm
Leaf mass4.8 mg
⚠ sources differ — AusTraits: 4.8 mg · LEDA: 13.01 mg
Leaf mass per area46.21 g/m2
Leaf size138 mm²
⚠ sources differ — TRY: 138 mm² · AusTraits: 103 mm² · LEDA: 362 mm² · GIFT: 362 mm²
Leaf width6.5 mm
⚠ sources differ — AusTraits: 6.5 mm · GIFT: 9 mm
Leaf width max20 mm
Leaf width min3 mm
Plant height0.719 m
⚠ sources differ — GIFT: 0.719 m · AusTraits: 0.1 m · LEDA: 1.14 m · TRY: 0.421 m
Plant height generative0.296 m
Plant height max1 m
Plant height min0.02 m
Seed length3.75 mm
⚠ sources differ — TRY: 3.75 mm · GIFT: 2.5 mm
Seed length max2.5 mm
Seed length min2.5 mm
Seed mass1.52 mg
⚠ sources differ — TRY: 1.52 mg · AusTraits: 1.3 mg · LEDA: 1.82 mg · GIFT: 1.47 mg
Seed mass max1.93 mg
Seed mass min0.765 mg
Seed volume0.78 mm³
Seed volume max0.78 mm³
Seed volume min0.78 mm³
Life cycle & reproduction20
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — AusTraits: barochory · LEDA: endozoochor · GIFT: unspecialized
Flower colourpink
Flower length max3 mm
Flower length min2.5 mm
Flowering endOct
Flowering startJun
Flowering timennnnnnnnynnn
Life formannual or perennial
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number3 081
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 200 m
Elevation mean2 352 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourblack
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate narrowly_elliptical
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio15.45 g/g
Leaf c426 mg/g
Leaf dry-matter content (LDMC)233 mg/g
⚠ sources differ — TRY: 233 mg/g · LEDA: 208 mg/g
Leaf n30.73 mg/g
Leaf p2.61 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)19.23 mm²/mg
⚠ sources differ — TRY: 19.23 mm²/mg · LEDA: 29.7 mm²/mg · GIFT: 28.88 mm²/mg
Wood density380 mg/cm³
Other traits3
Diaspore typegenerative dispersule
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition54 compounds
Compounds documented for Polygonum aviculare across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols21
Dihydroflavonols5
Cinnamic acids and derivatives4
Stigmastane steroids2
Oleanane triterpenoids2
Documented compounds54 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((2S,3R,4R,5R,6S)-2-(5,7-dihydroxy-4-oxo-2-(3,4,5-trihydroxyphenyl)chromen-3-yl)oxy-4,5-dihydroxy-6-methyloxan-3-yl) 3,4,5-trihydroxybenzoate | present | NPASS | |
| (+)-taxifolin | present | NPASS | |
| (1R,3S,4S,5S)-3-((E)-3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylic Acid | present | NPASS | |
| (2R)-2-(3,4-Dihydroxyphenyl)-3,5,7-Trihydroxy-2,3-Dihydrochromen-4-One | present | NPASS | |
| (2R,3S)-2-(3,4-Dihydroxyphenyl)-3,5,7-Trihydroxy-2,3-Dihydrochromen-4-One | present | NPASS | |
| (2S,3S,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid | present | NPASS | |
| 2,3-Dihydro-5,6,7-trimethoxy-2-(4-methoxyphenyl)-4H-1-benzopyran-4-one | present | NPASS | |
| 3,5,7,3',4'-Pentahydroxyflavanone | present | NPASS | |
| 3-[(2S,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one | present | NPASS | |
| 3-[(2S,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one | present | NPASS |
05DNA & barcoding122 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonum aviculare has left across the world's sequence archives.
At a glance
DNA specimens122
Marker genes10
GenBank sequences10
eDNA detections89
Countries15
The DNA barcodea real sequence read deposited for this species
CGGGTACTCGAGTCTTTGACGCAAGTTGCGCCCGAAGCCCTCGTGGCCAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCCCCAC …
Polygonum aviculare isolate XB_HM433 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★matK-like★rbcL3★rbcLa★trnL-F★ITS6★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceGoaT · NCBI
The complete instruction manual Polygonum aviculare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size909 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Polygonum aviculare0.91 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy4× tetraploid · measured
Chromosome records40–602n range40median40mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 403×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database — ↗
2n 601×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness92.6% BUSCO
08Occurrence & distribution
Record type513 970 records
Wild obs. + sensor476 599
Museum / vouchered36 255
Cultivated / captive105
Other1 011
Origin
Native21 707
Introduced6 201
Range
Area of Occupancy AOO577 304 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 67 107≤1 km 88 912≤10 km 227 697>10 km 3 448
387 164 georeferenced · 89 435 without coordinates
Open the mapobservation + sensor476 599
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 2 833≤1 km 8 692≤10 km 13 561>10 km 770
25 856 georeferenced · 10 399 without coordinates
Open the institutions mapphysical evidence36 255
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 17
19 georeferenced · 86 without coordinates
Open the mapnot free-living105
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions289 of 543 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 17 476 |
| Beijing, CN | 740 |
| Yangling, CN | 722 |
| DBF-NHMDlocation not on record | 708 |
| Moscow State Universitylocation not on record | 453 |
| Uppsala, SE | 371 |
| Salzburg, AT | 344 |
| Adelaide, AU | 328 |
| Olocation not on record | 310 |
| SLU Artdatabankenlocation not on record | 260 |
| LDlocation not on record | 247 |
| Philadelphia, US | 234 |
| Nanjing, CN | 234 |
| MeiseBGlocation not on record | 210 |
| Flagstaff, US | 207 |
| Chongqing Museumlocation not on record | 193 |
| Museo Entomologico de Leonlocation not on record | 190 |
| Berlin, DE | 188 |
| Adam Mickiewicz University in Poznańlocation not on record | 173 |
| BFLlocation not on record | 171 |
| Oregon State Universitylocation not on record | 170 |
| Riverside, US | 167 |
| Wuzhou, CN | 164 |
| Jyväskylä, FI | 158 |
| Bronx, US | 153 |
| Tartu, EE | 149 |
| ASUlocation not on record | 145 |
| Bergen, NO | 136 |
| Pretoria, ZA | 135 |
| Garðabær, IS | 132 |
| València, ES | 130 |
| MAlocation not on record | 130 |
| Kunming, CN | 128 |
| Xining, CN | 124 |
| Oskarshamn, SE | 118 |
| Trondheim, NO | 117 |
| KMNlocation not on record | 116 |
| Madison, US | 111 |
| Odawara, JP | 110 |
| Mount Annan, AU | 106 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 104 |
| Denver, US | 98 |
| Ann Arbor, US | 92 |
| Mlocation not on record | 92 |
| Santa Barbara, US | 90 |
| Görlitz, DE | 90 |
| TROMlocation not on record | 88 |
| Mexico City, MX | 88 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 87 |
| Canberra, AU | 83 |
| Turku, FI | 81 |
| South Kensington, GB | 79 |
| WTUlocation not on record | 79 |
| Tallinn, EE | 78 |
| Durango, MX | 78 |
| Wuhan, CN | 78 |
| Albuquerque, US | 77 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 77 |
| Brisbane, AU | 77 |
| Emporia, US | 76 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 76 |
| Karlsruhe, DE | 74 |
| Québec, CA | 73 |
| Urumqi, CN | 71 |
| BRNUlocation not on record | 71 |
| Entomological Society of Latvialocation not on record | 70 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 68 |
| Vitoria, ES | 68 |
| University of New Hampshirelocation not on record | 64 |
| Bozeman, US | 64 |
| Claremont, US | 61 |
| Nagano City, JP | 60 |
| Université Lavallocation not on record | 59 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 58 |
| Acadia Universitylocation not on record | 57 |
| Kensington, AU | 56 |
| Moscow, US | 52 |
| Chiba, JP | 52 |
| Auckland, NZ | 51 |
| Córdoba, AR | 51 |
| St. Paul, US | 51 |
| Wellington, NZ | 50 |
| Provincia di Livornolocation not on record | 50 |
| Hebei Normal Universitylocation not on record | 50 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 49 |
| Logan, US | 49 |
| San Diego, US | 47 |
| University of Stellenboschlocation not on record | 47 |
| Pullman, US | 46 |
| New Haven, US | 46 |
| Wlocation not on record | 46 |
| San Isidro, AR | 44 |
| Missoula, US | 44 |
| BDBClocation not on record | 43 |
| GMBAlocation not on record | 42 |
| Oulu, FI | 40 |
| Uniwersytet Śląski w Katowicachlocation not on record | 40 |
| National Institute of Biological Resourceslocation not on record | 40 |
| BClocation not on record | 40 |
| Irkutsk State Universitylocation not on record | 40 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 39 |
| Fort Worth, US | 39 |
| Kew, GB | 39 |
| Provo, US | 38 |
| EL PASO, US | 38 |
| Phoenix, US | 38 |
| College Park, US | 38 |
| San Luis Obispo, US | 38 |
| Williamsburg, US | 38 |
| Christchurch, NZ | 37 |
| Mexico City, MX | 37 |
| Austin, US | 37 |
| Allentown, US | 37 |
| Salamanca, ES | 34 |
| Zhengzhou, CN | 34 |
| Zürich, CH | 33 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 33 |
| Siouxland Heritage Museumlocation not on record | 33 |
| Armidale, AU | 33 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 32 |
| Montréal, CA | 32 |
| Badajoz, ES | 31 |
| Green Bay, US | 31 |
| Bern, CH | 31 |
| 31 | |
| Victoria, CA | 31 |
| Hobart, AU | 31 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 31 |
| Burlington, US | 31 |
| Arcata, US | 30 |
| Pamplona, ES | 30 |
| ZRC-SAZUlocation not on record | 30 |
| College of the Atlantic, Museumlocation not on record | 30 |
| Anchorage, US | 30 |
| Bando, JP | 30 |
| Barcelona, ES | 29 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 29 |
| Lanzhou, CN | 28 |
| NSMKlocation not on record | 27 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 27 |
| Strecker Museum, Baylor Universitylocation not on record | 27 |
| UGentlocation not on record | 26 |
| Pocatello, US | 26 |
| Angwin, US | 26 |
| Nijmegen, NL | 26 |
| Madrid, ES | 25 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 25 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 25 |
| Hangzhou, CN | 24 |
| Guilin, CN | 24 |
| Ischia Marine Centrelocation not on record | 24 |
| Saint John, CA | 24 |
| Canadian Department of Agriculturelocation not on record | 24 |
| CICYTEXlocation not on record | 24 |
| McWane Science Centerlocation not on record | 24 |
| Tampa, US | 24 |
| US | 23 |
| University of Wisconsinlocation not on record | 23 |
| Kyoto Universitylocation not on record | 22 |
| Zürich, CH | 22 |
| Sanda, JP | 22 |
| Phyletisches Museum Jenalocation not on record | 21 |
| BIO-UNIPIlocation not on record | 21 |
| Bangkok, TH | 21 |
| Chapel Hill, US | 21 |
| Guiyang, CN | 21 |
| Saint Louis, US | 20 |
| Xinxiang, CN | 20 |
| Xian, CN | 20 |
| DOI/NPS, Greenbelt Parklocation not on record | 19 |
| Awka, NG | 19 |
| Shanghai, CN | 19 |
| Chengdu, CN | 19 |
| Granada, ES | 19 |
| Fayetteville, US | 18 |
| Toronto, CA | 18 |
| Beijing Normal Universitylocation not on record | 18 |
| Cape Town, ZA | 18 |
| KR | 18 |
| Shanxi Universitylocation not on record | 18 |
| WINlocation not on record | 18 |
| BAYLUlocation not on record | 18 |
| Pamplona, ES | 17 |
| Fredericton Stock Culture Collectionlocation not on record | 17 |
| Morgantown, US | 17 |
| GJOlocation not on record | 17 |
| Urumqi, CN | 17 |
| Northeastern Forestry Universitylocation not on record | 17 |
| Córdoba, ES | 17 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 17 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| Corrientes, AR | 16 |
| Jackson, US | 16 |
| University of Alberta Museumslocation not on record | 16 |
| Paris, FR | 16 |
| DMZ botanic gardenlocation not on record | 15 |
| Guangzhou, CN | 15 |
| Inner Mongolia Universitylocation not on record | 15 |
| SXTCMlocation not on record | 15 |
| Fullerton, US | 15 |
| IFR-DNFlocation not on record | 15 |
| Alicante, ES | 15 |
| Jiangxi College of Educationlocation not on record | 14 |
| KOMlocation not on record | 14 |
| Shanxi Institute of Biologylocation not on record | 14 |
| Durban, ZA | 14 |
| Kochi, JP | 14 |
| KIRMlocation not on record | 14 |
| Vancouver, CA | 13 |
| Fundación Miguel Lillolocation not on record | 13 |
| Seoul, KR | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Corvallis, US | 12 |
| Castelar, AR | 12 |
| Dekalb, US | 12 |
| Elocation not on record | 12 |
| Palmerston, AU | 12 |
| UIBlocation not on record | 12 |
| CJBGlocation not on record | 12 |
| KURAlocation not on record | 12 |
| Laboratory of Palaeontologylocation not on record | 12 |
| Portland, US | 11 |
| Brookings, US | 11 |
| Umeå Universitylocation not on record | 11 |
| Juriquilla, MX | 11 |
| BAlocation not on record | 11 |
| Whitehorse, CA | 11 |
| ENTClocation not on record | 11 |
| sxphclocation not on record | 11 |
| Boise, US | 11 |
| Millersville, US | 10 |
| KIWElocation not on record | 10 |
| Durango, US | 10 |
| Tilburg, NL | 10 |
| Shanghai, CN | 10 |
| NMBU:MINAlocation not on record | 10 |
| Kandalaksha State Nature Reservelocation not on record | 10 |
| Nagatoro-machi, Chichibu-gun, JP | 10 |
| Tacoma, US | 10 |
| Chicago, US | 10 |
| Zhejiang Universitylocation not on record | 10 |
| Irvine, US | 10 |
| Taipei, TW | 10 |
| Long Beach, US | 10 |
| Montréal, CA | 9 |
| Washington, US | 9 |
| Tomioka, JP | 9 |
| Tianjin Natural History Museumlocation not on record | 9 |
| Davenport, US | 9 |
| Bourges, FR | 9 |
| Columbia, US | 9 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 9 |
| Chengdu, CN | 9 |
| SZUlocation not on record | 9 |
| IDElocation not on record | 9 |
| Tokushima, JP | 9 |
| Uniwersytet Opolskilocation not on record | 9 |
| San Angelo, US | 9 |
| Xiamen, CN | 9 |
| Lincoln, US | 9 |
| Keene State Universitylocation not on record | 8 |
| Puebla, MX | 8 |
| NSW Office of Environment and Heritagelocation not on record | 8 |
| Mendoza, AR | 8 |
| Northridge, US | 8 |
| Morelia, MX | 8 |
| IWEP FEB RASlocation not on record | 8 |
| Norfolk, US | 8 |
| Guiyang, CN | 8 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 8 |
| Staten Island, US | 8 |
| Dresden, DE | 7 |
| Jaén, ES | 7 |
| TUR-Alocation not on record | 7 |
| Taipei, TW | 7 |
| Spearfish, US | 7 |
| GZUlocation not on record | 7 |
| Pittsburg, US | 7 |
| Edmonton, CA | 7 |
| Rotorua, NZ | 7 |
| University of Guelph, OAC Herbariumlocation not on record | 7 |
| Sevilla, ES | 7 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 6 |
| Taiyuan Normal Universitylocation not on record | 6 |
| Denton, US | 6 |
| Obihiro Centennial City Museumlocation not on record | 6 |
| Universidad Católica de Santa Maríalocation not on record | 6 |
| BSBIlocation not on record | 6 |
| Frankfurt am Main | 6 |
| Guasave, MX | 6 |
| Fukushima Universitylocation not on record | 6 |
| Davis, US | 6 |
| Grand Junction, US | 6 |
| Caldwell, US | 6 |
| PRClocation not on record | 6 |
| Minia, EG | 6 |
| Institute of the biological problems of the North FEB RASlocation not on record | 6 |
| Wuhan, CN | 6 |
| Servico de Microbiologia e Imunologialocation not on record | 6 |
| Whitewater, US | 6 |
| Peking Universitylocation not on record | 6 |
| J. Rusek Collectionlocation not on record | 6 |
| Giardini Botanici Hanburylocation not on record | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| CASlocation not on record | 5 |
| Montecillo, Texcoco, MX | 5 |
| GAlocation not on record | 5 |
| Orem, US | 5 |
| Tula State Universitylocation not on record | 5 |
| Zapopan, MX | 5 |
| Beijing, CN | 5 |
| Zhejiang Museum of Natural Historylocation not on record | 5 |
| Guangzhou, CN | 5 |
| Hermosillo, MX | 5 |
| UChlocation not on record | 5 |
| nbflocation not on record | 5 |
| Blumenau, BR | 5 |
| New Brunswick, US | 5 |
| Torreón, MX | 5 |
| Bend, US | 5 |
| Chongqing Natural History Museumlocation not on record | 5 |
| Parkville, AU | 5 |
| National Biodiversity Institute, Costa Ricalocation not on record | 5 |
| Fulda, DE | 5 |
| Smithfield, AU | 4 |
| HUFDlocation not on record | 4 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Kingston, US | 4 |
| West China Subalpine Botanical Gardenlocation not on record | 4 |
| Fairfax, US | 4 |
| Aarhus, DK | 4 |
| AUAlocation not on record | 4 |
| Podgorica, ME | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Hudson, US | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Philadelphia, US | 4 |
| Ciudad de México, MX | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Guizhou Forestry Schoollocation not on record | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Santa Cruz, US | 4 |
| EEZA-CSIClocation not on record | 4 |
| Hunan Geological Museumlocation not on record | 4 |
| Valparaiso, CL | 4 |
| Universidad de Nariño (UdeNar)location not on record | 4 |
| 盐城国家级珍禽自然保护区location not on record | 4 |
| Mexico City, MX | 4 |
| USFSlocation not on record | 4 |
| Herbarium of South China Botanical Gardenlocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Asheville, US | 4 |
| University of Lethbridgelocation not on record | 4 |
| Kushiro City Museumlocation not on record | 4 |
| US | 4 |
| nlocation not on record | 3 |
| Riobamba, EC | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Anchorage, US | 3 |
| Mississippi State, US | 3 |
| Mohonk Preservelocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Ciudad Autónoma de Buenos Aires, AR | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| Henderson, US | 3 |
| Museo universitario di Chietilocation not on record | 3 |
| Palmerston North, NZ | 3 |
| Taipei, TW | 3 |
| Brasília, BR | 3 |
| Dover, US | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Knoxville, US | 3 |
| DNSMlocation not on record | 3 |
| Richmond, US | 3 |
| 重庆市药物种植研究所药用植物标本馆location not on record | 3 |
| Cambridge, US | 3 |
| Los Angeles, US | 3 |
| JBSlocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| KNAMlocation not on record | 3 |
| Mount Pleasant, US | 3 |
| Macomb, US | 3 |
| Osaka, JP | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Winterthur, CH | 3 |
| National Museum Waleslocation not on record | 3 |
| Gijón, ES | 3 |
| McGill University, Herbariumlocation not on record | 3 |
| Stockholm, SE | 3 |
| Chapingo, MX | 3 |
| Minot State Universitylocation not on record | 3 |
| Philadelphia, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Turlock, US | 3 |
| Museum of the Rockieslocation not on record | 2 |
| Edinburgh, GB | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Pondicherry, IN | 2 |
| TAIElocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| USFS/BHSClocation not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Chadron, US | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Muzaffarabad, PK | 2 |
| Russellville, US | 2 |
| Boumlocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Lubbock, US | 2 |
| Portland, US | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Nunoa, Santiago, CL | 2 |
| QVMAGlocation not on record | 2 |
| San Francisco, US | 2 |
| SEFlocation not on record | 2 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 2 |
| Changsha, CN | 2 |
| Quito, EC | 2 |
| Cuenca, EC | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| Cheney, US | 2 |
| Göteborg, SE | 2 |
| Xian, CN | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Chinese Academy of Forestrylocation not on record | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Bandelier National Monumentlocation not on record | 2 |
| Lausanne, CH | 2 |
| Stephenville, US | 2 |
| H-Schuhwlocation not on record | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| Weber State Universitylocation not on record | 2 |
| Culiacán, MX | 2 |
| Salvador, BR | 2 |
| Durham, US | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Clemson, US | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| Little Rock, US | 2 |
| US | 2 |
| ULBF-AGRlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| San Jose, US | 1 |
| Bothell, US | 1 |
| ISAlocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| IATMlocation not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Loja, EC | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Glocation not on record | 1 |
| 东北师范大学自然博物馆location not on record | 1 |
| FJIDClocation not on record | 1 |
| Guatemala City, GT | 1 |
| EMTCMlocation not on record | 1 |
| GNWPlocation not on record | 1 |
| Linares, MX | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Zacatecas, MX | 1 |
| PrivatHerblocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Banyoles, ES | 1 |
| LfUlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Ypsilanti, US | 1 |
| Tuscaloosa, US | 1 |
| Oswego, US | 1 |
| Porrentruy, CH | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Chengdu, CN | 1 |
| Zunyi Normal Collegelocation not on record | 1 |
| Cochabamba, BO | 1 |
| FLADlocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| SJNAlocation not on record | 1 |
| BGPAlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| US | 1 |
| Batemans Bay, AU | 1 |
| Ashland, US | 1 |
| UoB-IBlocation not on record | 1 |
| LNBG$location not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Tsukuba, JP | 1 |
| Namur, BE | 1 |
| Porvoo, FI | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Kathmandu, NP | 1 |
| NoColllocation not on record | 1 |
| ESP003location not on record | 1 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| IMMUlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Ensenada, MX | 1 |
| Waverly, US | 1 |
| Monastir, TN | 1 |
| Sant Julià de Lòria, AD | 1 |
| Museo de La Platalocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Helsinki, FI | 1 |
| Wollongong, AU | 1 |
| Sion, CH | 1 |
| BGBMlocation not on record | 1 |
| Brussel, BE | 1 |
| Truckee, US | 1 |
| Bratislava, SK | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Kuopio, FI | 1 |
| Chicago, US | 1 |
| Ivano-Frankove, UA | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| 武陵山动植物研究所location not on record | 1 |
| Nanjing, CN | 1 |
| ESP109location not on record | 1 |
543 institutions · 34 339 of 36 255 vouchered records shown · 1 498 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA89 detections
Where the DNA of Polygonum aviculare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found89
Studies independent surveys1
Countries13
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 89 detections have coordinates
Open the map13 countries0
Disturbed roadside.Riparian with Juncus spp., Baccharis salicif…Roadside, disturbed dry area behind North en…Disturbed area along road.Gravelly soil in disturbed area.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C -2.20–20.2
Seasonal swing summer↔winter26.4 °C
Max temp (day)18.2 °C 1.70–25.5
Min temp (night)10.4 °C -7.00–15.8
Precipitation70.4 mm/mo 36.6–107
Air humidity60.2 % 52.2–63.7
Moisture balance-28.0 mm/mo -84.1–20.7
Vapour deficit631 Pa 364–1,058
Wind speed3.30 m/s 2.10–5.40
Cloud cover48.3 % 29.4–58.5
CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.