Polygonum arenastrum
Boreau · speciesAt a glance
Occurrence records52 955
Data sources13
Biological traits55
DNA specimens17
eDNA detections21
Sources13 archives
Databases and archives Polygonum arenastrum's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility52 955 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionLOTUS1 compounds
Occurrence & distributionGBIF52 955 records
Environmental DNA1 datasets · 4 countries21 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB721 Mbp
01Narrative
Polygonum arenastrum, commonly known as equal-leaved knotgrass, is a summer annual flowering plant in the knotweed family Polygonaceae. Other common names include common knotweed, prostrate knotweed, mat grass, oval-leaf knotweed, stone grass, wiregrass, and door weed, as well as many others. It is native to EuropeAltervista Flora Italiana, Polygonum arenarium Waldst. & Kit. includes European distribution map and can be found on other continents as an introduced species and a common noxious weed. Knotweed was first seen in North America in 1809 and is now seen across much of the United States and Canada.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology23
Fruit length2.25 mm
⚠ sources differ — AusTraits: 2.25 mm · GIFT: 2.12 mm
Fruit length max2.5 mm
Fruit length min2 mm
Fruit width1.35 mm
Leaf length14 mm
⚠ sources differ — AusTraits: 14 mm · GIFT: 12.5 mm
Leaf length max30 mm
Leaf length min5 mm
Leaf size316 mm²
Leaf width3.5 mm
Leaf width max11 mm
Leaf width min2 mm
Plant height0.146 m
⚠ sources differ — GIFT: 0.146 m · LEDA: 0.112 m · TRY: 0.1 m
Plant height max0.7 m
Plant height min0.05 m
Seed length2.3 mm
Seed length max2.3 mm
Seed length min2.3 mm
Seed mass0.932 mg
⚠ sources differ — TRY: 0.932 mg · LEDA: 1.54 mg · GIFT: 1.11 mg
Seed mass max0.86 mg
Seed mass min0.86 mg
Seed volume5.6 mm³
Seed volume max5.6 mm³
Seed volume min5.6 mm³
Life cycle & reproduction13
Deciduousnessevergreen
⚠ sources differ — TRY: always summer green · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeunspecialized
Flowering endOct
Flowering startJul
Life formannual
Life spanannual
Lifespan years1 years
Raunkiær life formtherophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 300 m
Elevation mean160 m
Elevation min70 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
Habitat GIFTforest, mountains, roadsides, sand
Leaf compoundnesssimple
Leaf shapenarrowly_elliptical narrowly_ovate
Woodinessnon-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.75
Other traits1
Diaspore typefruit with appendage
03Chemical composition1 compounds
Compounds documented for Polygonum arenastrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Simple phenolic acids1
Documented compounds1 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| protocatechuate | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonum arenastrum has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes4
GenBank sequences10
eDNA detections21
Countries4
The DNA barcodea real sequence read deposited for this species
TCGAAACCTGCGAGAGCAGAAAGACCCGCGAACACGTTGTTAAACAAAAAGCCCGGGCTCGCAAGGCCCGGCACCAACAAAACCCCGGCG …
Polygonum arenastrum voucher MO:Darigo, Darigo N4131 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★ITS7★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Polygonum arenastrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size721 025 510 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Polygonum arenastrum0.72 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy4× tetraploid · measured
Chromosome records20–602n range40median40mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4034×CCDB · ita-fl · CCDB · brit-fl · CCDB · iber-fl +6
CCDB · ita-fl — RAFFAELLI M. - 1982. Contributi alla conoscenza del genere Polygonum L. 4. Le specie italiane della sect. Polygonum.. Webbia , 35(2): 361-406.
CCDB · brit-fl — Styles, B.T. Watsonia 5: 177-214 (1962)
CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 64-85. Queirs, M.Bol. Soc. Brot. ser. 256: 79-98(1983).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2019
CCDB · book-ipcn65 — Mertens & R. 1965
CCDB · ipcn-api-dl — Krzak, J. 1982. Chromosome numbers within Polygonum aviculare L. s.l. from Poland. Acta Biol. Cracov., Ser. Bot. 24: 1–10.
CCDB · ipcn-api-dl — Queiros, M. 1983a. Números cromossómicos para a Flora Portugesa, 64-85. Bol. Soc. Brot. 56: 79–98.
CCDB · ipcn-api-dl — Wolf, S. J. & J. McNeill. 1987. Cytotaxonomic studies on Polygonum section Polygonum in eastern Canada and the adjacent United States. Canad. J. Bot. 65: 647–652.
CCDB · ipcn-api-dl — Raffaelli, M. 1982. Contributi alla conoscenza del genere Polygonum L. 4. Le specie italiane della sect. Polygonum. Webbia 35: 361–406.
CCDB · ipcn-api-dl — Albers, F. & R. Wisskirchen. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · book-fedorov — Andersson (LOve A., Love D. 1948)
CCDB · book-fedorov — LOve A., LOve D. 1956a
CCDB · book-fedorov — Pauwels 1959a
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Gervais, C. (2000). Documentation chromosomique. Contribution no 1 Ludoviciana 29: 74-79
CCDB · CromoCat 2015 — Queirós, M. (1983b). Números cromossómicos para a flora portuguesa, 64-85. Bol. Soc. Brot. 56: 79-98.
CCDB · CromoCat 2015 — Raffaelli, M. (1982). Contributi alla conoscenza del genere Polygonum L. 4. Le specie italiane della sect. Polygonum. Webbia 35: 361-406.
CCDB · CromoCat 2015 — Wolf, S. J. & J. Mcneill. (1987). Cytotaxonomic studies on Polygonum section Polygonum in easthern Canada and the adjacent United States. Canad. J. Bot. 65: 647-652.
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
CCDB · CromoCat 2015 — Jaretzky, R. (1927b). Einige chromosomenzahlen aus der familie der Polygonaceae. Ber. Deutsch. Bot. Ges. 45: 48-54.
CCDB · CromoCat 2015 — Jaretzky, R. (1928a). Histologische und karyologische studien an Polygonaceen. Jahrb. Wiss. Bot. 69: 357-490.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1942b). Cytotaxonomic studies on boreal plants. I. Some observations on Swedish and Icelandic plants. Kungl. Fysiogr. Sällsk. Lund Förhandl. 12: 1-19.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Pauwels, L. (1959). Études critiques sur quelques Polygonum de Belgique. Bull. Soc. Roy. Bot. Belg. 91: 291-297.
CCDB · CromoCat 2015 — Pólya, L. (1948). Chromosome numbers of certain alkali plants. Arch. Biol. Hung. 18: 145-148.
CCDB · CromoCat 2015 — Scholz, H. (1960). Bestimmungsschüssel für die sammelart Polygonum aviculare L. Verh. Bot. Vereins Prov. Brandenburg 98/100: 180-182.
CCDB · CromoCat 2015 — Styles, B. T. (1959a). Polygonum aviculare in Britain. Proc. Bot. Soc. Brit. Isles 3: 336.
CCDB · CromoCat 2015 — Styles, B. T. (1959b). The taxonomy of the British knotgrasses. Brit. Ecol. Soc. 1959: 48-54.
CCDB · CromoCat 2015 — Styles, B. T. (1960). Taxonomical and cytological studies in the genus Polygonum. Oxford
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 504-507.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIV]. Taxon 31(1): 124-126.
2n 604×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Krzak, J. 1982. Chromosome numbers within Polygonum aviculare L. s.l. from Poland. Acta Biol. Cracov., Ser. Bot. 24: 1–10.
CCDB · ipcn-api-dl — Strid, A. 1986. Chromosome Number Reports 93. Taxon 35: 901–902.
CCDB · CromoCat 2015 — Strid, A. (1986). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XCIII]. Taxon 35(4): 901-902.
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
2n 203×CCDB · iapt · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
2n 221×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
2n 301×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
2n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
2n 501×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yurtseva, O. V. (2002). Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type52 955 records
Wild obs. + sensor48 997
Museum / vouchered3 937
Cultivated / captive2
Other19
Origin
Native902
Introduced7 194
Range
Area of Occupancy AOO103 092 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy38% within 1 km
≤100 m 4 664≤1 km 12 353≤10 km 27 278>10 km 358
44 653 georeferenced · 4 344 without coordinates
Open the mapobservation + sensor48 997
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 303≤1 km 628≤10 km 744>10 km 673
2 348 georeferenced · 1 589 without coordinates
Open the institutions mapphysical evidence3 937
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions118 of 201 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 616 |
| Moscow State Universitylocation not on record | 340 |
| BFLlocation not on record | 249 |
| Uniwersytet Warszawskilocation not on record | 160 |
| Turku, FI | 141 |
| Madison, US | 124 |
| Olocation not on record | 120 |
| BIO-UNIPIlocation not on record | 100 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 99 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 84 |
| Tartu, EE | 84 |
| Berlin, DE | 80 |
| Oulu, FI | 71 |
| Museo Entomologico de Leonlocation not on record | 59 |
| MAlocation not on record | 57 |
| Claremont, US | 56 |
| Philadelphia, US | 54 |
| Adelaide, AU | 51 |
| Nagano City, JP | 42 |
| Mlocation not on record | 42 |
| Görlitz, DE | 36 |
| Canberra, AU | 35 |
| Provincia di Livornolocation not on record | 35 |
| GMBAlocation not on record | 34 |
| Canadian Department of Agriculturelocation not on record | 31 |
| Trondheim, NO | 27 |
| Kensington, AU | 27 |
| Hobart, AU | 26 |
| Auckland, NZ | 26 |
| Vitoria, ES | 26 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 26 |
| Rishon Le Zion, IL | 23 |
| València, ES | 20 |
| Odawara, JP | 18 |
| College of the Atlantic, Museumlocation not on record | 16 |
| KMNlocation not on record | 16 |
| Bergen, NO | 16 |
| South Kensington, GB | 16 |
| BRNUlocation not on record | 16 |
| Irkutsk State Universitylocation not on record | 16 |
| Tsukuba, JP | 16 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 15 |
| TUR-Alocation not on record | 15 |
| Christchurch, NZ | 15 |
| Mexico City, MX | 14 |
| Wellington, NZ | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Tallinn, EE | 12 |
| LDlocation not on record | 12 |
| DOI/NPS, Greenbelt Parklocation not on record | 12 |
| GZUlocation not on record | 12 |
| Sevilla, ES | 11 |
| Salamanca, ES | 11 |
| Victoria, CA | 11 |
| Mount Annan, AU | 11 |
| Wlocation not on record | 11 |
| Barcelona, ES | 11 |
| Fulda, DE | 10 |
| Badajoz, ES | 10 |
| Madrid, ES | 9 |
| IWEP FEB RASlocation not on record | 9 |
| WTUlocation not on record | 9 |
| College Park, US | 8 |
| Sagamihara, JP | 8 |
| Phyletisches Museum Jenalocation not on record | 8 |
| Acadia Universitylocation not on record | 8 |
| Chiba, JP | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 8 |
| CICYTEXlocation not on record | 7 |
| Alicante, ES | 7 |
| Québec, CA | 7 |
| Rotorua, NZ | 7 |
| Kew, GB | 7 |
| Granada, ES | 6 |
| Kuopio, FI | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| BClocation not on record | 6 |
| San Francisco, US | 6 |
| Vancouver, CA | 6 |
| University of Alberta Museumslocation not on record | 6 |
| Frankfurt am Main | 6 |
| Tomioka, JP | 5 |
| Córdoba, ES | 5 |
| Porvoo, FI | 5 |
| PrivatHerblocation not on record | 5 |
| Turlock, US | 5 |
| McWane Science Centerlocation not on record | 5 |
| US | 5 |
| ZRC-SAZUlocation not on record | 5 |
| Uppsala, SE | 5 |
| TROMlocation not on record | 5 |
| Jyväskylä, FI | 5 |
| Brisbane, AU | 4 |
| Museo Achille Folettolocation not on record | 4 |
| VALElocation not on record | 4 |
| Zürich, CH | 4 |
| SZUlocation not on record | 4 |
| Mexico City, MX | 4 |
| Forssa, FI | 4 |
| Fort Worth, US | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| Université Lavallocation not on record | 4 |
| EL PASO, US | 4 |
| Coimbra, PT | 4 |
| Denver, US | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Philadelphia, US | 3 |
| Obihiro Centennial City Museumlocation not on record | 3 |
| Bando, JP | 3 |
| GJOlocation not on record | 3 |
| Jaén, ES | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| Lausanne, CH | 3 |
| NSW Office of Environment and Heritagelocation not on record | 3 |
| Riverside, US | 3 |
| ASUlocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| JBSlocation not on record | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Chicago, US | 3 |
| BGBMlocation not on record | 3 |
| New Haven, US | 3 |
| München, DE | 3 |
| Taipei, TW | 2 |
| Arizona State University Biocollectionslocation not on record | 2 |
| Montréal, CA | 2 |
| Museum of the Rockieslocation not on record | 2 |
| PRClocation not on record | 2 |
| Toronto, CA | 2 |
| Burlington, US | 2 |
| Austin, US | 2 |
| Ensenada, MX | 2 |
| Irvine, US | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Los Angeles, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Wollongong, AU | 2 |
| Chongqing Museumlocation not on record | 2 |
| San Diego, US | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Caldwell, US | 2 |
| Karlsruhe, DE | 2 |
| Trois-Rivières, CA | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Fort Bragg, US | 1 |
| Corvallis, US | 1 |
| La Trobe Universitylocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Dekalb, US | 1 |
| Palmerston, AU | 1 |
| Zürich, CH | 1 |
| CASlocation not on record | 1 |
| Logan, US | 1 |
| Xining, CN | 1 |
| Davis, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| CJBGlocation not on record | 1 |
| Pamplona, ES | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Honolulu, US | 1 |
| San Francisco, US | 1 |
| Moscow, US | 1 |
| QVMAGlocation not on record | 1 |
| Tampa, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Pullman, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Durango, US | 1 |
| Fullerton, US | 1 |
| Gijón, ES | 1 |
| Grand Junction, US | 1 |
| SJNAlocation not on record | 1 |
| Armidale, AU | 1 |
| H-AkrKGlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Edmonton, CA | 1 |
| Nishihara, JP | 1 |
| St. Paul, US | 1 |
| Phoenix, US | 1 |
| UIBlocation not on record | 1 |
| Durango, MX | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| National Marine Biodiversity Institute of Korealocation not on record | 1 |
| Richmond, US | 1 |
| BSBIlocation not on record | 1 |
| Henderson, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| KURAlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| La Paz, MX | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Flagstaff, US | 1 |
| Chicago, US | 1 |
| Pocatello, US | 1 |
| Bronx, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Hiratsuka City Museumlocation not on record | 1 |
201 institutions · 3 769 of 3 937 vouchered records shown · 163 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Polygonum arenastrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map4 countries0
Riparian with Salix spp., Baccharis salicifo…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median-2.20 °C -2.20–16.2
Seasonal swing summer↔winter43.2 °C
Max temp (day)1.70 °C 1.70–18.9
Min temp (night)-7.00 °C -7.00–13.1
Precipitation36.6 mm/mo 36.6–80.1
Air humidity60.4 % 60.4–63.5
Moisture balance-10.1 mm/mo -26.9–4.60
Vapour deficit364 Pa 364–668
Wind speed2.10 m/s 2.10–3.60
Cloud cover58.5 % 42.5–58.5
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.