Polygonum arenarium

Waldst. & Kit. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Polygonum

At a glance

Occurrence records1 099

Data sources10

Biological traits20

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Polygonum arenarium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 099 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 099 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Спорыш песчаный, — вид травянистых растений рода Спорыш (Polygonum) семейства Гречишные (Polygonaceae). Встречается также под устаревшим синонимичным названием Горец песчаный.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology3

Plant height max0.9 m

Plant height min0.15 m

Seed mass1.13 mg

Life cycle & reproduction5

Flowering endOct

Flowering startJul

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTcrop fields, saline places, sand, shores, steppe

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)411 mg/g

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Polygonum arenarium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Quercetin 3-alpha-D-galactoside		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonum arenarium has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ339924.1 ↗544 bpRussia · 2003

ACGT

TCGAAACCTGCGAGAGCAGAAAGACCCGCGAACATGTTGTTAAACTAAAAGCCCGGGCTCACAAGGCTCGGCACCAACAAAACCCCGGCG …

Polygonum arenarium voucher MW<RUS>:Yurtseva N8 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Polygonum arenarium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · nw-europe-fl · CCDB · ipcn-api-dl

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2024

CCDB · ipcn-api-dl — Yurtseva, O. V. 2002. Chromosome numbers of Polygonum species, section Polygonum (Polygonaceae) from Russia and adjacent countries. Bot. Žhurn. (Moscow & Leningrad) 87(5): 151–153.

CCDB · ipcn-api-dl — Baden, C. 1983. Chromosome numbers in some Greek angiosperms. Willdenowia 13: 335–336.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 099 records

Wild obs. + sensor581

Museum / vouchered513

Other5

Origin

Native1

Introduced47

Range

Area of Occupancy AOO3 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 109≤1 km 40≤10 km 207>10 km 27

383 georeferenced · 198 without coordinates

Open the mapobservation + sensor581

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 12≤1 km 73≤10 km 63>10 km 10

158 georeferenced · 355 without coordinates

Open the institutions mapphysical evidence513

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	211
Moscow State Universitylocation not on record	91
BRNUlocation not on record	40
LDlocation not on record	36
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	28
Wlocation not on record	10
Adam Mickiewicz University in Poznańlocation not on record	7
Pretoria, ZA	5
College of the Atlantic, Museumlocation not on record	4
Philadelphia, US	3
Barcelona, ES	2
Görlitz, DE	2
Bern, CH	2
Córdoba, AR	2
Madison, US	2
Uniwersytet Śląski w Katowicachlocation not on record	1
MAlocation not on record	1
Rishon Le Zion, IL	1
BSBIlocation not on record	1
IFR-DNFlocation not on record	1
MeiseBGlocation not on record	1
Corrientes, AR	1
Mlocation not on record	1
ASUlocation not on record	1
Salzburg, AT	1
Uppsala, SE	1
PRClocation not on record	1
Santa Barbara, US	1
South Kensington, GB	1
Brussel, BE	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Wellington, NZ	1

32 institutions · 462 of 513 vouchered records shown · 49 without an institution code

09Environmental DNA2 detections

Where the DNA of Polygonum arenarium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter43.2 °C

Max temp (day)1.70 °C

Min temp (night)-7.00 °C

Precipitation36.6 mm/mo

Air humidity60.4 %

Moisture balance-10.1 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Polygonum arenarium

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 099 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 099 records