Polygonatum verticillatum
(L.) All. · speciesAt a glance
Occurrence records109 526
Data sources11
Biological traits56
DNA specimens25
eDNA detections18
Sources11 archives
Databases and archives Polygonatum verticillatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility109 526 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources56 traits
Occurrence & distributionGBIF109 526 records
Environmental DNA1 datasets · 3 countries18 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB · GoaT8.3 Gbp
01Narrative
Le Sceau-de-Salomon verticillé est une plante herbacée vivace, rhizomateuse, de la famille des Asparagacées. Certains la classent parmi les Liliacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology21
Fruit length7.3 mm
Fruit length max8 mm
Fruit length min6 mm
Fruit width8 mm
Fruit width max9 mm
Fruit width min6 mm
Leaf length80 mm
Leaf length max100 mm
Leaf length min60 mm
Leaf mass24.28 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 003 mm² · GIFT: 1 003 mm²
Leaf width max30 mm
Leaf width min20 mm
Plant height0.42 m
⚠ sources differ — GIFT: 0.42 m · LEDA: 0.42 m · TRY: 0.575 m
Plant height generative0.27 m
Plant height max0.8 m
Plant height min0.2 m
Seed length2.84 mm
Seed mass29.6 mg
⚠ sources differ — TRY: 29.6 mg · LEDA: 66.47 mg · GIFT: 39.36 mg
Seed mass max29.6 mg
Seed mass min29.6 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startMay
Life formrhizomatous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number198
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 700 m
Elevation mean2 825 m
Elevation min1 500 m
Epiphyteterrestrial
Fruit typeberry
Growth formherb
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio19.66 g/g
Leaf c457 mg/g
Leaf dry-matter content (LDMC)152 mg/g
Leaf n23.51 mg/g
Leaf p1.75 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)42.43 mm²/mg
Other traits1
Diaspore typegenerative dispersule
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polygonatum verticillatum has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes6
GenBank sequences10
eDNA detections18
Countries4
The DNA barcodea real sequence read deposited for this species
GTCTCGGGCATCTACCATTATACCCAAAATGATTGGCCATACAATCGCTGTTCATAATGGAAAAGAACATTTACCTATTTATATAACAGA …
Polygonatum verticillatum chloroplast, complete genome
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL10★rbcLa★ITS★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Polygonatum verticillatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size8 253 621 428 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Polygonatum verticillatum8.25 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records14–842n range28median28mode50records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2829×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +8
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Skali?ska M., Pogan E. et al. 1971 a. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov. Ser. Bot. 14, 199-211.
CCDB · poland — Su?ek E. 1977. Karyological studies in Polygonatum Mill. II. Karyotype analysis of P. verticillatum (L.) All. Acta Biol. Cracov. Ser. Bot. 20, 25-32.
CCDB · book-ipcn65 — Abramova 1965
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Pandita, T. K. 1979. Cytological investigations of some monocots of Kashmir. Ph.D. Thesis, Chandigarh 1979.
CCDB · ipcn-api-dl — Baltisberger, M., D. Dähler & S. Horat. 2002. Karyologische Untersuchungen an den schweizerischen Arten der Gattung Polygonatum. Bot. Helv. 112(2): 91–101.
CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — ABRAMOVA, L.J. A karyosystematic survey of the species of Polygonatum Mill. indigenous to the U.S.S.R. (in Russian) Bot. Zurn. 56: 530-543.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn67-71 — SKALINSKA, M. E. POGAL ET AL. 1971. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov., Ser. Bot. 14: 198-213.
CCDB · book-northern-plants — Junell (L. & L. I942 b).
CCDB · book-indian_vol2 — Berg, K.H. von 1933; Tischler, G. 1934; June! (Love, A. & , LHve, D. 1942b) ; Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov) ; Mehra, P.N. & Pathania,R.S. 1960a ; Abramova, L.I. 1965 ; Polatschek, A. 1966b ; Majovsky, J. et al. 1970b ; Abramova, LJ. 1971 ; Laane, M.M. 1971 ; Lovka, M. et al. 1971, 1972 ; Skali6.ska, M. & Pogan, E. 1971 ; Sulek, E. 1977
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E., Hellmayr, E., Walter, J., Tschenett, J., Justin, C. & Mann, M. (1991). Beiträge zur Flora von Österreich: Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 128: 19-39
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 788-791.
CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 337-339.
CCDB · CromoCat 2015 — Mehra, P. N. & T. K. Pandita. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 387-388.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Popova, M. (1973a). Kariologicno proucvane v rod Polygonatum Adans. Naucni Trudove (Plovdiv) 22(1): 63 -68.
2n 308×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · ipcn-api-dl +4
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · ipcn-api-dl — Roy, S. C., S. Ghosh & A. Chatterjee. 1988. A cytological survey of eastern Himalayan plants. II. Cell Chromosome Res. 11: 93–97.
CCDB · book-ipcn66 — Kurosawa 1966
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-ipcn73-74 — SEN, S. 1973. Structural hybridity intra-and interspecific level in Liliales. Folia Biol. (Cracow) 21: 83-197.
CCDB · book-indian_vol2 — Kurosawa, S. 1966
CCDB · CromoCat 2015 — Mehra, P. N. & T. K. Pandita. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 387-388.
2n 243×CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-indian_vol2 — Mattiek (Tischler, G. 1950) .
CCDB · CromoCat 2015 — Shao, J.-Z., D.-C. Zhang, J.-G. Yang, C.-H. Yao & F. Qian. (1993). Karyotype analysis of 5 species of Polygonatum Mill. Acta Phytotax. Sin. 31:353-361
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
2n 142×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Polatschek, A. (1965). Cytotaxonomische Beitrage zur Flora des Ostalpelander. Diss. Universität Wien pp. 130+X
CCDB · CromoCat 2015 — Polatschek, A. (1966b). Cytotaxonomische Beitrage zur Flora des Ostalpelander. II Österr. Bot. Z. 113(2): 101-147.
2n 602×CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · book-indian_vol2 — Sachdeva, S.K. & Malik, C.P. 1977
CCDB · CromoCat 2015 — Mehra, P. N. & T. K. Pandita. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 387-388.
2n 842×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Shao, J.-Z., D.-C. Zhang, J.-G. Yang, C.-H. Yao & F. Qian. (1993). Karyotype analysis of 5 species of Polygonatum Mill. Acta Phytotax. Sin. 31:353-361
2n 541×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yang, J., J.-W. Wang & M.-X. Li. (1992). Cytotaxonomic studies on the genus Polygonatum III. Chromosome numbers and karyotypes of 6 species from China. J. Wuhan Bot. Res. 10:201-206
2n 581×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yang, J., J.-W. Wang & M.-X. Li. (1992). Cytotaxonomic studies on the genus Polygonatum III. Chromosome numbers and karyotypes of 6 species from China. J. Wuhan Bot. Res. 10:201-206
2n 661×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mehra, P.N. & Pathania, R.S. 1960b
n 143×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · book-ipcn66 — Polatschek 1966
CCDB · book-ipcn67-71 — ABRAMOVA, L.J. A karyosystematic survey of the species of Polygonatum Mill. indigenous to the U.S.S.R. (in Russian) Bot. Zurn. 56: 530-543.
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
n 152×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Roy, S. C., S. Ghosh & A. Chatterjee. 1988. A cytological survey of eastern Himalayan plants. II. Cell Chromosome Res. 11: 93–97.
CCDB · CromoCat 2015 — Roy, S. C., S. Ghosh & A. Chatterjee. (1988). A cytological survey of eastern Himalayan plants. II. Cell Chromosome Res. 11: 93-97.
n 91×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 18
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.723 ↗
08Occurrence & distribution
Record type109 526 records
Wild obs. + sensor99 274
Museum / vouchered6 293
Cultivated / captive163
Other3 796
Origin
Native162
Introduced18
Range
Area of Occupancy AOO108 092 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 23 759≤1 km 14 955≤10 km 40 359>10 km 372
79 445 georeferenced · 19 829 without coordinates
Open the mapobservation + sensor99 274
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 494≤1 km 1 340≤10 km 1 998>10 km 162
3 994 georeferenced · 2 299 without coordinates
Open the institutions mapphysical evidence6 293
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 11>10 km 3
14 georeferenced · 149 without coordinates
Open the mapnot free-living163
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions70 of 150 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 499 |
| Olocation not on record | 674 |
| Trondheim, NO | 420 |
| BFLlocation not on record | 318 |
| LDlocation not on record | 285 |
| Salzburg, AT | 228 |
| Beijing, CN | 196 |
| Bergen, NO | 171 |
| KMNlocation not on record | 155 |
| MeiseBGlocation not on record | 149 |
| TROMlocation not on record | 127 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 124 |
| BIO-UNIPIlocation not on record | 108 |
| Uppsala, SE | 97 |
| Yangling, CN | 79 |
| Bern, CH | 76 |
| Chengdu, CN | 68 |
| Lanzhou, CN | 62 |
| Adam Mickiewicz University in Poznańlocation not on record | 61 |
| Moscow State Universitylocation not on record | 61 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 60 |
| Kunming, CN | 60 |
| Xining, CN | 58 |
| Oskarshamn, SE | 57 |
| Dresden, DE | 47 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 43 |
| Chengdu, CN | 42 |
| Zürich, CH | 41 |
| Chengdu, CN | 36 |
| MAlocation not on record | 34 |
| BDBClocation not on record | 34 |
| Zürich, CH | 33 |
| Mlocation not on record | 31 |
| Görlitz, DE | 21 |
| SLU Artdatabankenlocation not on record | 18 |
| South Kensington, GB | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Entomological Society of Latvialocation not on record | 17 |
| No collectionlocation not on record | 16 |
| Barcelona, ES | 16 |
| Vitoria, ES | 15 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Wuhan, CN | 14 |
| BRNUlocation not on record | 13 |
| València, ES | 13 |
| Wlocation not on record | 13 |
| Frankfurt am Main | 13 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 12 |
| LfUlocation not on record | 12 |
| Edinburgh, GB | 12 |
| PRClocation not on record | 12 |
| PTHlocation not on record | 11 |
| NMBU:MINAlocation not on record | 11 |
| Provincia di Livornolocation not on record | 11 |
| Palacký University in Olomouclocation not on record | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| BClocation not on record | 9 |
| Porrentruy, CH | 8 |
| Kathmandu, NP | 8 |
| Nanjing, CN | 8 |
| Berlin, DE | 7 |
| Salamanca, ES | 7 |
| GJOlocation not on record | 7 |
| nbflocation not on record | 6 |
| Herb. BBGlocation not on record | 6 |
| H-Wolflocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| University of Birminghamlocation not on record | 5 |
| Zhengzhou, CN | 5 |
| Podgorica, ME | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Saint Louis, US | 5 |
| Institute of Botany, Ilia State Universitylocation not on record | 5 |
| GMBAlocation not on record | 5 |
| CASlocation not on record | 4 |
| Dehra Dun, IN | 4 |
| SXTCMlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Frauenfeld, CH | 3 |
| GZUlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| Glarus, CH | 3 |
| Tromso University Museumlocation not on record | 3 |
| Tilburg, NL | 3 |
| Karlsruhe, DE | 3 |
| PrivatHerblocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| New Haven, US | 3 |
| Madrid, ES | 3 |
| Guangzhou, CN | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| UoB-IBlocation not on record | 2 |
| Wellington, NZ | 2 |
| Nanchong, CN | 2 |
| UGentlocation not on record | 2 |
| Seoul, KR | 2 |
| Xinxiang, CN | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Pamplona, ES | 2 |
| Namur, BE | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| Paris, FR | 2 |
| FLADlocation not on record | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Taipei, TW | 2 |
| Monastir, TN | 2 |
| Kew, GB | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Stockholm, SE | 2 |
| Auckland, NZ | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Chongqing Natural History Museumlocation not on record | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| SZUlocation not on record | 1 |
| Dhaka, BD | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Dekalb, US | 1 |
| US | 1 |
| Flagstaff, US | 1 |
| Durham, US | 1 |
| Boise, US | 1 |
| Xiamen, CN | 1 |
| Chongqing Museumlocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| Chicago, US | 1 |
| CJBNlocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Fulda, DE | 1 |
| McManus: Dundee's Art Gallery & Museumlocation not on record | 1 |
| SCAUlocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| Porvoo, FI | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Granada, ES | 1 |
| Alicante, ES | 1 |
| Gijón, ES | 1 |
| Peking Universitylocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Taipei, TW | 1 |
| Logan, US | 1 |
150 institutions · 6 106 of 6 293 vouchered records shown · 164 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA18 detections
Where the DNA of Polygonatum verticillatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found18
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 18 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.70 °C 2.40–14.0
Seasonal swing summer↔winter15.1 °C
Max temp (day)11.6 °C 4.70–15.8
Min temp (night)3.90 °C -0.7–10.1
Precipitation97.5 mm/mo 78.2–129
Air humidity64.2 % 62.1–69.5
Moisture balance22.1 mm/mo -0.1–66.2
Vapour deficit400 Pa 220–606
Wind speed3.50 m/s 2.70–6.70
Cloud cover53.1 % 47.6–64.8
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.